Genome Editing Reveals Idiosyncrasy of CNGA2 Ion Channel-Directed Antibody Immunoreactivity Toward Oxytocin

Blechman, Janna; Anbalagan, Savani; Matthews, Gary; Levkowitz, Gil

doi:10.3389/fcell.2018.00117

Cited by 11 publications

(7 citation statements)

References 34 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…Our previous immunohistochemical analysis on developing 5-dpf larvae failed to co-localize GFAP-immuno-reactive cells and AgRP2-expressing cells [14]. The reasons for these contradictory results may be the early developmental stage of the pineal gland in the immunostaining analysis and/or the use of an antibody directed to mammalian GFAP [32].…”

Section: Agrp2 Is Not Required For Food Consumptionmentioning

confidence: 85%

Agouti-Related Protein 2 Is a New Player in the Teleost Stress Response System

et al. 2019

View full text Add to dashboard Cite

Agouti-related protein (AgRP) is a hypothalamic regulator of food consumption in mammals. However, AgRP has also been detected in circulation, but a possible endocrine role has not been examined. Zebrafish possess two agrp genes: hypothalamically expressed agrp1, considered functionally equivalent to the single mammalian agrp, and agrp2, which is expressed in pre-optic neurons and uncharacterized pineal gland cells and whose function is not well understood. By ablation of AgRP1-expressing neurons and knockout of the agrp1 gene, we show that AgRP1 stimulates food consumption in the zebrafish larvae. Single-cell sequencing of pineal agrp2-expressing cells revealed molecular resemblance to retinal-pigment epithelium cells, and anatomic analysis shows that these cells secrete peptides, possibly into the cerebrospinal fluid. Additionally, based on AgRP2 peptide localization and gene knockout analysis, we demonstrate that pre-optic AgRP2 is a neuroendocrine regulator of the stress axis that reduces cortisol secretion. We therefore suggest that the ancestral role of AgRP was functionally partitioned in zebrafish by the two AgRPs, with AgRP1 centrally regulating food consumption and AgRP2 acting as a neuroendocrine factor regulating the stress axis.

show abstract

Section: Agrp2 Is Not Required For Food Consumptionmentioning

confidence: 85%

Agouti-Related Protein 2 Is a New Player in the Teleost Stress Response System

et al. 2019

View full text Add to dashboard Cite

show abstract

“…Our previous data showed that mutant oxtr (−/−) fish exhibit an impaired oxytocinergic signalling (validation of the line in Nunes et al). Zebrafish genotyping was performed according with the procedure described by Blechamnn et al. The region of interest was amplified by a polymerase chain reaction (PCR) and sequenced using the primers: sense 5′‐TGCGCGAGGAAAACTAGTT‐3′ and antisense 5′ AGCAGACACTCAGAATGGTCA‐3′.…”

Section: Methodsmentioning

confidence: 99%

Oxytocin receptor signalling modulates novelty recognition but not social preference in zebrafish

Ribeiro

Nunes

Gliksberg

et al. 2020

J Neuroendocrinology

Self Cite

View full text Add to dashboard Cite

| INTRODUC TI ONNonapeptides are known to be important players in the regulation of social behaviour across taxa. 1 They evolved from a common ancestral molecule, the arginine vasotocin, after a gene duplication event in early-jawed fish. 2 One copy originated the vasopressin-like peptides, which retained the most primitive functions of the ancestral molecule, namely the regulation of osmotic balance. The other originated the oxytocin (OXT)-like peptides, which have greatly diverged across species, being recruited for diverse homeostatic processes, including parturition and lactation in mammals. Throughout evolution, these nonapeptides have also been involved in the regulation of social behaviours, with vasopressin being more involved in aggression and agonistic behaviours and OXT in affiliative behaviours and sociality. 3 AbstractSociality is a complex phenomenon that involves the individual´s motivation to approach their conspecifics, along with social cognitive functions that enable individuals to interact and survive. The nonapeptide oxytocin (OXT) is known to regulate sociality in many species. However, the role of OXT in specific aspects of sociality is still not well understood. In the present study, we investigated the contribution of the OXT receptor (OXTR) signalling in two different aspects of zebrafish social behaviour: social preference, by measuring their motivation to approach a shoal of conspecifics, and social recognition, by measuring their ability to discriminate between a novel and familiar fish, using a mutant zebrafish lacking a functional OXTR. Although oxtr mutant zebrafish displayed normal attraction to a shoal of conspecifics, they exhibited reduced social recognition. We further investigated whether this effect would be social-domain specific by replacing conspecific fish by objects. Although no differences were observed in object approach, oxtr mutant fish also exhibited impaired object recognition. Our findings suggest that OXTR signalling regulates a more general memory recognition of familiar vs novel entities, not only in social but also in a non-social domain, in zebrafish. K E Y W O R D Sautism spectrum disorders, oxytocin, social preference, social recognition, zebrafish S U PP O RTI N G I N FO R M ATI O NAdditional supporting information may be found online in the Supporting Information section.

show abstract

“…we employed genome editing as previously described 62,63 , with slight modifications. Cas9 protein was produced by the Weizmann Institute of Science Protein Purification Unit using the pET-28b-Cas9-His (Alex Schier Lab Plasmids, Addgene, Cambridge, MA, United States) as a template.…”

Section: Genome Editing Using Crispr/cas9 To Generate the Hopless Wzmentioning

confidence: 99%

Splice-specific deficiency of the PTSD-associated gene PAC1 leads to a paradoxical age-dependent stress behavior

Biran

Gliksberg

Shirat

et al. 2020

Sci Rep

Self Cite

View full text Add to dashboard Cite

The pituitary adenylate cyclase-activating polypeptide receptor (PAC1, also known as ADCYAP1R1) is associated with post-traumatic stress disorder and modulation of stress response in general. Alternative splicing of PAC1 results in multiple gene products, which differ in their mode of signalling and tissue distribution. However, the roles of distinct splice variants in the regulation of stress behavior is poorly understood. Alternative splicing of a short exon, which is known as the "hop cassette", occurs during brain development and in response to stressful challenges. To examine the function of this variant, we generated a splice-specific zebrafish mutant lacking the hop cassette, which we designated 'hopless'. We show that hopless mutant larvae display increased anxiety-like behavior, including reduced dark exploration and impaired habituation to dark exposure. Conversely, adult hopless mutants displayed superior ability to rebound from an acute stressor, as they exhibited reduced anxiety-like responses to an ensuing novelty stress. We propose that the developmental loss of a specific PAC1 splice variant mimics prolonged mild stress exposure, which in the long term, predisposes the organism's stress response towards a resilient phenotype. Our study presents a unique genetic model demonstrating how early-life state of anxiety paradoxically correlates with reduced stress susceptibility in adulthood. PAC1 (a.k.a. Adcyap1r1) is a G-protein coupled receptor (GPCR) that serves as the high-affinity receptor for the pituitary adenylate cyclase-activating polypeptide (PACAP). PAC1 has pleiotropic functions and was demonstrated to be involved in the regulation of several homeostatic processes including metabolic rate and food consumption 1,2 , circadian rhythm 3 and, in particular, stress response 4,5. Intracerebroventricular injection of PACAP increased phosphorylated cyclic AMP response element binding protein (pCREB) and corticotropin-releasing hormone (CRH) immunoreactivity in the rat paraventricular nucleus 6. PACAP knockout mice display blunted hypothalamic CRH levels in response to restraint challenge 7. PACAP/PAC1 signaling was also associated with hypothalamo-pituitary-adrenal activity and stress-related behaviors in humans and rodents 5,8,9. Furthermore, this pathway was correlated with stress-related risky behaviors in human and rodents 10,11. Overall, these findings support positive stress regulation by PAC1; yet, some reports suggest that it may also act to suppress stress phenotypes 4,12. It has been suggested that genetic vulnerability to post-traumatic stress disorder (PTSD) may depend on PAC1 expression and single-nucleotide polymorphism (SNP) in the PAC1 gene. Ressler et al. demonstrated that a specific PAC1 genotype is strongly correlated with susceptibility to PTSD in women, probably due to perturbed expression of PAC1 resulting in impaired stress responses 13. The same PAC1 SNP was associated with PTSD in African-American females, emotional numbing in traumatized earthquake Chinese survivors, dark-e...

show abstract

Genome Editing Reveals Idiosyncrasy of CNGA2 Ion Channel-Directed Antibody Immunoreactivity Toward Oxytocin

Cited by 11 publications

References 34 publications

Agouti-Related Protein 2 Is a New Player in the Teleost Stress Response System

Agouti-Related Protein 2 Is a New Player in the Teleost Stress Response System

Oxytocin receptor signalling modulates novelty recognition but not social preference in zebrafish

Splice-specific deficiency of the PTSD-associated gene PAC1 leads to a paradoxical age-dependent stress behavior

Contact Info

Product

Resources

About