Genome Engineering ofDrosophilawith the CRISPR RNA-Guided Cas9 Nuclease

Abstract

We have adapted a bacterial CRISPR RNA/Cas9 system to precisely engineer the Drosophila genome and report that Cas9-mediated genomic modifications are efficiently transmitted through the germline. This RNA-guided Cas9 system can be rapidly programmed to generate targeted alleles for probing gene function in Drosophila.

Gene regulatory mechanisms underlying the intestinal innate immune response

“…In addition, it is proving an ideal model to study the molecular and physiological role of the intestinal microbiota in post-embryonic development and homeostasis [57][58][59]. Finally, the Drosophila community has generated an extensive experimental toolkit including TF clone libraries [60] and TF overexpression fly lines [61], in vivo transgenic enhancer lines [62,63] as well as genome engineering tools such as CRISPR [64][65][66], rendering the Drosophila gut an ideal model to achieve a level of mechanistic, regulatory understanding that may currently be unattainable for the mammalian gastrointestinal tract.…”

CRISPR-induced null alleles show that Frost protects Drosophila melanogaster reproduction after cold exposure

“…We generated four Fst mutant lines (two independent insertion alleles Fst ins-1 and Fst ins-2 , and two independent deletion alleles Fst del-1 and Fst del-2 ) in y 1 Df(1) w 67c23.2 (y w) D. melanogaster using CRISPR-Cas9-mediated homologous recombination (Gratz et al, 2013). Each mutant line was produced by independent gene disruptions/homologous recombination events.…”

“…Each mutant line was produced by independent gene disruptions/homologous recombination events. pU6-BbsI-chiRNA was used to construct two plasmids expressing chiRNA (chimeric RNA) guides that recognize the Fst sequences A (GCCTTGGTG-GCAGTGGCTTC) and B (GTAAAACCATTTCTAGGGTT) (Gratz et al, 2013). Two repair templates were constructed with ordered assembly of BsaI restriction fragments into pFusA using Golden Gate cloning (Cermak et al, 2011).…”

Functional and Genetic Analysis of Spectraplakins in Drosophila

“…In CRISPR, the Streptococcus-derived RNA-guided DNA endonuclease Cas9 (CRISPR-associated protein 9) induces DNA double-strand breaks at sites for which complementary RNA sequences of 20 nucleotide length are provided in the form of small guide RNA (sgRNA) constructs. If two Cas9-dependent double-strand breaks are induced, this can be used to generate targeted deletions (Bassett, Tibbit, Ponting, & Liu, 2013;Gratz et al, 2013). If a construct for homology-directed repair (containing homology regions of around 1 kb) is provided in parallel, the cutout genomic section can be replaced by any sequence of choice.…”

“…If suitable markers were inserted during the process, successful targeting events can be screened 10 days after injection when the individual flies eclose. Further improvements of CRISPR technology in flies include transgenic nanos-Cas9 fly lines (stably expressing Cas9 in the germ line, so that Cas9 RNA or plasmid no longer needs to be coinjected; Ren et al, 2013), optimized sgRNA expression vectors (Port, Chen, Lee, & Bullock, 2014), and the development of online resources to facilitate construct design and prediction of potential off-target sites (Bassett et al, 2013;Gratz et al, 2013;Hsu et al, 2013;Ren et al, 2013;Yu et al, 2013). To keep up to date with CRISPR technology in Drosophila, a number of dedicated Web pages are available (http://www.…”