Genome of the Psychrophilic Bacterium Bacillus psychrosaccharolyticus, a Potential Source of 2′-Deoxyribosyltransferase for Industrial Nucleoside Synthesis

Fresco-Taboada, Alba; Cerro, Carlos del; Fernández‐Lucas, Jesús; Arroyo, Miguel; Acebal, Carmen; Garcı́a, José Luis; Mata, Isabel de la

doi:10.1128/genomea.00309-13

Cited by 6 publications

(3 citation statements)

References 17 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…Likewise, two enzymes with biotechnological application from B. psychrosaccharolyticus have been described: (i) alanine racemase, which showed high catalytic activity even at 0 • C and was extremely labile above 35 • C [37]; and (ii) lactate dehydrogenase, widely used in diagnostics and analytical applications [38]. Interestingly, B. psychrosaccharolyticus whole cells have been also reported to display nucleoside 2 -deoxyribosyltransferase activity [24] and the analysis of its genome permitted the identification of the ndt gene that codifies a putative NDT [9]. Subsequently, this gene was cloned and overexpressed and the recombinant protein produced and immobilized [25,39].…”

Section: Discussionmentioning

confidence: 99%

2′-Deoxyribosyltransferase from Bacillus psychrosaccharolyticus: A Mesophilic-Like Biocatalyst for the Synthesis of Modified Nucleosides from a Psychrotolerant Bacterium

et al. 2018

Self Cite

View full text Add to dashboard Cite

Structure-function relationships of a novel 2 -deoxyribosyltransferase from the psychrotolerant bacterium Bacillus psychrosaccharolyticus (BpNDT) have been exhaustively studied by biochemical and high resolution crystallographic analyses. Despite BpNDT exhibiting some structural features characteristic of cold-adapted enzymes such as localized flexibility in critical loops, its biochemical properties are typical of mesophilic enzymes. BpNDT is a highly symmetrical homohexamer with tightly associated subunits that possesses flexible and short loops bordering the active sites. The catalytic center is essentially identical to that of other mesophilic homologues. Moreover, BpNDT shows that it is a mesophilic-like enzyme since it is not heat-labile and exhibits an apparent unfolding temperature (T m ) of 49 • C, being active during 96 h at 40 and 50 • C. Finally, BpNDT synthesizes natural and modified nucleosides, with preference for purines as acceptors and pyrimidine nucleosides as donors. Remarkably, the synthesis of several therapeutic nucleosides has been efficiently carried out. In this sense, 5-hydroxymethyl-2 -deoxyuridine (5-HMdUrd), 7-deaza-6-hydroxypurine-2 -deoxyriboside (7-DHPdRib) and theophylline-2 -deoxyriboside were synthesized for the first time by an NDT enzyme, showing the biotechnological interest of BpNDT.

show abstract

Section: Discussionmentioning

confidence: 99%

2′-Deoxyribosyltransferase from Bacillus psychrosaccharolyticus: A Mesophilic-Like Biocatalyst for the Synthesis of Modified Nucleosides from a Psychrotolerant Bacterium

et al. 2018

Self Cite

View full text Add to dashboard Cite

show abstract

“…The ndt gene encoding nucleoside 2'-deoxyribosyltransferase from B. psychrosaccharolyticus was amplified by PCR using chromosomal DNA from B. psychrosaccharolyticus CECT 4074 as a template, obtained as described by Kieser [41]. Two synthetic primers were designed according to the sequence of B. psychrosaccharolyticus genome [13], 5'-C CCATGG CGAAAATTTACCTAGCTTCA CCAT-3' and 5'-G GAATTC TTATTTAACTGCTTTTAAGTACGGTTTAATAGG-3', containing the restriction sites of Nco I and Eco RI (underlined). DNA amplification was performed under standard conditions in a Mastercycler thermocycler (Eppendorf) using Pfu DNA polymerase.…”

Section: Methodsmentioning

confidence: 99%

“…The psychrophilic microorganism Bacillus psychrosaccharolyticus (CECT 4074, ATCC 23296, DSM 6) has been reported to display nucleoside 2'-deoxyribosyltransferase activity [10], demonstrating that this facultative anaerobic Gram-positive bacterium could be a NDT source. In this sense, the genome of B. psychrosaccharolyticus has been recently published and the ndt gene that codifies a putative NDT has been identified in its genome [13].…”

Section: Introductionmentioning

confidence: 99%

Nucleoside 2'-Deoxyribosyltransferase from Psychrophilic Bacterium Bacillus psychrosaccharolyticus — Preparation of an Immobilized Biocatalyst for the Enzymatic Synthesis of Therapeutic Nucleosides

et al. 2014

Self Cite

View full text Add to dashboard Cite

Nucleoside 2'-deoxyribosyltransferase (NDT) from the psychrophilic bacterium Bacillus psychrosaccharolyticus CECT 4074 has been cloned and produced for the first time. A preliminary characterization of the recombinant protein indicates that the enzyme is an NDT type II since it catalyzes the transfer of 2'-deoxyribose between purines and pyrimidines. The enzyme (BpNDT) displays a high activity and stability in a broad range of pH and temperature. In addition, different approaches for the immobilization of BpNDT onto several supports have been studied in order to prepare a suitable biocatalyst for the one-step industrial enzymatic synthesis of different therapeutic nucleosides. Best results were obtained by adsorbing the enzyme on PEI-functionalized agarose and subsequent cross-linking with aldehyde-dextran (20 kDa and 70% oxidation degree). The immobilized OPEN ACCESSMolecules 2014, 19 11232 enzyme could be recycled for at least 30 consecutive cycles in the synthesis of 2'-deoxyadenosine from 2'-deoxyuridine and adenine at 37 °C and pH 8.0, with a 25% loss of activity. High conversion yield of trifluridine (64.4%) was achieved in 2 h when 20 mM of 2'-deoxyuridine and 10 mM 5-trifluorothymine were employed in the transglycosylation reaction catalyzed by immobilized BpNDT at 37 °C and pH 7.5.

show abstract

Microbial adaptation to different environmental conditions: molecular perspective of evolved genetic and cellular systems

et al. 2022

View full text Add to dashboard Cite

Microorganisms are ubiquitous on Earth and can inhabit almost every environment. In a complex heterogeneous environment or in face of ecological disturbance, the microbes adjust to fluctuating environmental conditions through a cascade of cellular and molecular systems. Their habitats differ from cold microcosms of Antarctica to the geothermal volcanic areas, terrestrial to marine, highly alkaline zones to the extremely acidic areas, and freshwater to brackish water sources. The diverse ecological microbial niches are attributed to the versatile, adaptable nature under fluctuating temperature, nutrient availability, and pH of the microorganisms. These organisms have developed a series of mechanisms to face the environmental changes and thereby keep their role in mediate important ecosystem functions. The underlying mechanisms of adaptable microbial nature are thoroughly investigated at the cellular, genetic and molecular levels. The adaptation is mediated by a spectrum of processes like natural selection, genetic recombination, horizontal gene transfer, DNA damage repair, and pleiotropy-like events. This review paper provides the fundamentals insight about the microbial adaptability besides highlighting the molecular network of microbial adaptation under different environmental conditions.

show abstract

Genome of the Psychrophilic Bacterium Bacillus psychrosaccharolyticus, a Potential Source of 2′-Deoxyribosyltransferase for Industrial Nucleoside Synthesis

Cited by 6 publications

References 17 publications

2′-Deoxyribosyltransferase from Bacillus psychrosaccharolyticus: A Mesophilic-Like Biocatalyst for the Synthesis of Modified Nucleosides from a Psychrotolerant Bacterium

2′-Deoxyribosyltransferase from Bacillus psychrosaccharolyticus: A Mesophilic-Like Biocatalyst for the Synthesis of Modified Nucleosides from a Psychrotolerant Bacterium

Nucleoside 2'-Deoxyribosyltransferase from Psychrophilic Bacterium Bacillus psychrosaccharolyticus — Preparation of an Immobilized Biocatalyst for the Enzymatic Synthesis of Therapeutic Nucleosides

Microbial adaptation to different environmental conditions: molecular perspective of evolved genetic and cellular systems

Contact Info

Product

Resources

About