Genome-wide identification of chromatin-enriched RNA reveals that unspliced dentin matrix protein-1 mRNA regulates cell proliferation in squamous cell carcinoma

Dynamic changes in chromatin accessibility during the differentiation of dental pulp stem cells reveal that induction of odontogenic gene expression is linked with specific enhancer construction

“…2 ). ncRNAs are generally involved in key cellular functions 24 , 25 , 26 and act as transcriptional regulators by guiding transcriptional factor complexes into specific gene loci and modulating subcellular protein localization, thereby regulating cellular properties such as proliferation and migration.…”

Procyanidin B2 enhances anti-inflammatory responses of periodontal ligament cells by inhibiting the dominant negative pro-inflammatory isoforms of peroxisome proliferator-activated receptor γ

“…Entire mRNA sequence identification was conducted as described previously. 24 PPARG isoforms were amplified from the human PDLF cDNA sample using KOD DNA Polymerase (Toyobo Life Science, Tokyo, Japan) with a forward primer (AAGGCCATTTTCTCAAACGA) associating exon 2 and a reverse primer (CTGCAGTAGCTGCACGTGTT) associating exon 8 of full-length PPARG (ENST00000397010.7 PPARG-205).…”

The histone deacetylase inhibitor MS-275 enhances the matrix mineralization of dental pulp stem cells by inducing fibronectin expression

“…siRNAs were forward-transfected into DPSCs at a final concentration of 10 nM using Lipofectamine RNAiMAX (Thermo Fisher Scientific) reagent and incubated for 24 h, as previously described. 31 32 …”