Genome-wide resources of endoribonuclease-prepared short interfering RNAs for specific loss-of-function studies

Kittler, Ralf; Surendranath, Vineeth; Heninger, Anne-Kristin; Słabicki, Mikołaj; Theis, Mirko; Putz, Gabriele; Franke, Kristin; Caldarelli, Antonio; Grabner, Hannes; Kozak, Karol; Wagner, Jan; Rees, Effi; Korn, Bernd; Frenzel, Corina; Sachse, Christoph; Sönnichsen, Birte; Guo, Jie; Schelter, Janell M.; Burchard, Julja; Linsley, Peter S.; Jackson, Aimee L.; Habermann, Bianca; Buchholz, Frank

doi:10.1038/nmeth1025

Cited by 171 publications

(131 citation statements)

References 28 publications

Supporting

Mentioning

125

Contrasting

Order By: Relevance

“…siRNAs were created by in vitro cleavage of Ogt doublestranded RNA (54). A PCR product for in vitro transcription of Ogt RNA was generated using the primers OgtF GGGCGGGTAAAGAGAAGGGCAGTGTTGC and OgtR GGGCGGGTCTTGTGAATGGAGGCCAGAT.…”

Section: Lc-ms/ms Lc-ms/ms Of O-glcnacylated Peptides Was Performed mentioning

confidence: 99%

Polycomb repressive complex 2 is necessary for the normal site-specific O -GlcNAc distribution in mouse embryonic stem cells

Myers¹,

Panning

Burlingame³

2011

Proc. Natl. Acad. Sci. U.S.A.

134

View full text Add to dashboard Cite

The monosaccharide addition of an N-acetylglucosamine to serine and threonine residues of nuclear and cytosolic proteins (O-GlcNAc) is a posttranslational modification emerging as a general regulator of many cellular processes, including signal transduction, cell division, and transcription. The sole mouse O-GlcNAc transferase (OGT) is essential for embryonic development. To understand the role of OGT in mouse development better, we mapped sites of O-GlcNAcylation of nuclear proteins in mouse embryonic stem cells (ESCs). Here, we unambiguously identify over 60 nuclear proteins as OGlcNAcylated, several of which are crucial for mouse ESC cell maintenance. Furthermore, we extend the connection between OGT and Polycomb group genes from flies to mammals, showing Polycomb repressive complex 2 is necessary to maintain normal levels of OGT and for the correct cellular distribution of O-GlcNAc. Together, these results provide insight into how OGT may regulate transcription in early development, possibly by modifying proteins important to maintain the ESC transcriptional repertoire.EED | Host Cell Factor C1 | electron transfer dissociation

show abstract

Section: Lc-ms/ms Lc-ms/ms Of O-glcnacylated Peptides Was Performed mentioning

confidence: 99%

Polycomb repressive complex 2 is necessary for the normal site-specific O -GlcNAc distribution in mouse embryonic stem cells

Myers¹,

Panning

Burlingame³

2011

Proc. Natl. Acad. Sci. U.S.A.

134

View full text Add to dashboard Cite

show abstract

“…5 In addition to single gene knockdown, investigators developed RNAi libraries to discover gene pathways controlling various cellular processes and facilitate global understanding of cellular behavior. 6 --9 This approach was used to identify genes that are involved in proteasome-mediated proteolysis, 10 virus infection and replication, 11 --14 cytokinesis, 8,9,15,16 endocytosis, 17 stem cell self-renewal 18 or cancer cell proliferation and survival. 19,20 RNAi knockdown requires a good selection strategy to link genetic information to cellular phenotype.…”

Section: Introductionmentioning

confidence: 99%

A novel lentivirus for quantitative assessment of gene knockdown in stem cell differentiation

et al. 2012

View full text Add to dashboard Cite

Loss of gene function is a valuable tool for screening genes in cellular processes including stem cell differentiation differentiation. However, the criteria for evaluating gene knockdown are usually based on end-point analysis and real-time, dynamic information is lacking. To overcome these limitations, we engineered a shRNA encoding LentiViral Dual Promoter vector (shLVDP) that enabled real-time monitoring of mesenchymal stem (MSC) differentiation and simultaneous gene knockdown. In this vector, the activity of the alpha-smooth muscle actin (aSMA) promoter was measured by the expression of a destabilized green fluorescent protein, and was used as an indicator of myogenic differentiation; constitutive expression of discosoma red fluorescent protein was used to measure transduction efficiency and to normalize aSMA promoter activity; and shRNA was encoded by a doxycycline (Dox)-regulatable H1 promoter. Importantly, the normalized promoter activity was independent of lentivirus titer allowing quantitative assessment of gene knockdown. Using this vector, we evaluated 11 genes in the TGF-b1 or Rho signaling pathway on SMC maturation and on MSC differentiation along the myogenic lineage. As expected, knockdown of genes such as Smad2/3 or RhoA inhibited myogenic differentiation, while knocking down the myogenic differentiation inhibitor, Klf4, increased aSMA promoter activity significantly. Notably, some genes for example, Smad7 or KLF4 showed differential regulation of myogenic differentiation in MSC from different anatomic locations such as bone marrow and hair follicles. Finally, Dox-regulatable shRNA expression enabled temporal control of gene knockdown and provided dynamic information on the effect of different genes on myogenic phenotype. Our data suggests that shLVDP may be ideal for development of lentiviral microarrays to decipher gene regulatory networks of complex biological processes such as stem cell differentiation or reprogramming.

show abstract

“…p21-luc (ref. esiRNA preparation and library construction were carried out as previously described 61 . Typically, HCT116 cells were transfected in 384-well plates with 25 ng esiRNA and 0.25 µl Oligofectamine (Invitrogen) in 10 µl OptiMem (Invitrogen).…”

Section: Methodsmentioning

confidence: 99%

A systematic RNAi synthetic interaction screen reveals a link between p53 and snoRNP assembly

et al. 2011

Self Cite

View full text Add to dashboard Cite

TP53(tumour protein 53) is one of the most frequently mutated genes in human cancer and its role during cellular transformation has been studied extensively. However, the homeostatic functions of p53 are less well understood. Here, we explore the molecular dependency network of TP53 through an RNAi-mediated synthetic interaction screen employing two HCT116 isogenic cell lines and a genome-scale endoribonuclease-prepared short interfering RNA library. We identify a variety of TP53 synthetic interactions unmasking the complex connections of p53 to cellular physiology and growth control. Molecular dissection of the TP53 synthetic interaction with UNRIP indicates an enhanced dependency of TP53-negative cells on small nucleolar ribonucleoprotein (snoRNP) assembly. This dependency is mediated by the snoRNP chaperone gene NOLC1 (also known as NOPP140 ), which we identify as a physiological p53 target gene. This unanticipated function of TP53 in snoRNP assembly highlights the potential of RNAi-mediated synthetic interaction screens to dissect molecular pathways of tumour suppressor genes.More than 30 years of intense research on the tumour suppressor gene TP53 has revealed its relevance in many aspects of tumour biology (reviewed in ref. 1). It is now well established that p53 (the protein product of TP53) activation leads to the execution of a complex genetic program that limits cellular proliferation and leads to senescence or apoptosis 2,3 . Several lines of evidence have pointed to an under-appreciated homeostasis function of p53 in normal, unstressed cells 4 . As a transcription factor, p53 can mediate the expression levels of its target genes, thereby adjusting cellular homeostasis of basic metabolism 5 , balance of reactive oxygen species 6,7 , stem cell identity and reprogramming 8 and animal reproduction 9 . These data establish an important role for p53 in cellular homeostasis and indicate that p53-loss-of-function cells become genetically rewired in a way that discriminates them from wild-type cells, a premise that could be explored for the identification of possible p53 genetic dependencies.Synthetic interaction screens have led the way in identifying new and unanticipated functional interactions between seemingly unrelated protein complexes in yeast 10,11 . In mammalian cells, RNA interference (RNAi)-based synthetic interaction screens are a promising approach to dissect genetic dependencies and the first studies on mammalian synthetic interactions of oncogenes have demonstrated the power of this approach 12,13 . Furthermore, synthetic lethal screens have identified genes that sensitize cells to different chemical drugs 14,15 . Several synthetic interactions with tumour suppressor genes have also been published 11,16 , but to our knowledge a genome-scale survey for synthetic interactions of a tumour suppressor gene has not been reported. Here, we present the results of a systematic investigation of TP53 genetic dependencies and characterize in molecular detail a homeostatic function of p53 in snoRNP biogen...

show abstract

Genome-wide resources of endoribonuclease-prepared short interfering RNAs for specific loss-of-function studies

Cited by 171 publications

References 28 publications

Polycomb repressive complex 2 is necessary for the normal site-specific O -GlcNAc distribution in mouse embryonic stem cells

Polycomb repressive complex 2 is necessary for the normal site-specific O -GlcNAc distribution in mouse embryonic stem cells

A novel lentivirus for quantitative assessment of gene knockdown in stem cell differentiation

A systematic RNAi synthetic interaction screen reveals a link between p53 and snoRNP assembly

Contact Info

Product

Resources

About