Genomic characterization of self-incompatibility ribonucleases (S-RNases) in European pear cultivars and development of PCR detection for 20 alleles

Abstract

Sexual self-incompatibility in European pear (Pyrus communis L.) is controlled by a single locus (Slocus) encoding a polymorphic stylar ribonuclease (S-RNase) that is responsible for the female function in pollen-pistil recognition. In this study, genomic DNA sequences corresponding to five new S-RNase alleles (named S 20 , S 21 , S 22 , S 23 , and S 24 ) and to S m were characterized in European pear cultivars. Re-sequencing S q from 'General Le Clerc' showed this S-RNase to encode the same protein as S 12 . Based on these findings, a polymerase chain reaction (PCR)-based method was developed for the molecular typing of cultivars bearing 20 S-RNases (S 1 -S 14 , S m , and S 20 -S 24 ) using consensus and allele-specific primers. Genomic PCR with consensus primers amplified product sizes characteristic of the S-RNases S 1 , S 2 , S 4 , S 10 , S 13 , and S 20 . However, the allele groups S 3 /S 12 , S 6 /S 8 /S 11 /S 22 and S 5 /S 7 /S 9 /S 14 /S m /S 21 / S 23 /S 24 amplified PCR products of similar size. To discriminate between alleles within these groups, primers to specifically amplify each S-RNase were developed. Application of this approach in 19 cultivars with published Salleles allowed re-evaluation of one of the alleles of 'Passe Crassane,' 'Conference,' and 'Condo.' Finally, this method was used to assign S-genotypes to 37 cultivars. Test crosses confirmed molecular results.

Pollinizer Efficacy of Several ‘Ingeborg’ Pear Pollinizers in Hardanger, Norway, Examined Using Microsatellite Markers

“…S-genotyping of 'Ingeborg' revealed that this cultivar possesses the following three S alleles: S102, S108, and S121, labeled in accordance with the numeration proposed by Goldway et al (2009). Considering 'Ingeborg', parent cultivar 'Conference' possesses S108 and S121 S alleles (Sanzol, 2009), whereas the other parent 'Bonne Louise' possesses S101 and S102 S alleles (Sanzol and Robbins, 2008), and the obtained S allele profile confirms the conclusion by Sehic et al (2012) that 'Ingeborg' is derived from an unreduced 'Conference' egg cell being fertilized by a haploid pollen cell from 'Bonne Louise'. The results of S-genotyping obtained for the five pollinizer cultivars revealed that only 'Anna' possesses an S allele already present in 'Ingeborg' (S108), making it a semicompatible pollinizer (manuscript is in press).…”

“…SSR profiles were scored using GeneMapper Software ID v3.2 (Applied Biosystems). S-genotyping of cultivars for S1-S24 based on a PCR approach was performed using consensus and allele specific primers published by Sanzol (2009), applying PCR protocols detailed in the same study. Flowering dates (beginning of flowering, full bloom, and petal fall) were recorded for each orchard during 2014 and 2016 to determine the flowering overlap between the main commercial cultivar and the pollinizers.…”

“…Consequently, interplanting of suitable pollinizer genotypes in pear orchards is essential for fertilization of the ovules, which in itself is necessary for a successful set of an optimum crop load (Webster, 2002). Identifying cross-compatible pear cultivars is traditionally accomplished with testcrosses and more recently using polymerase chain reaction (PCR) based S-genotyping (Mota et al, 2007;Quinet et al, 2014;Sanzol, 2009). However, planting cross-compatible pollinizers, which have coincidental flowering time overlap with the main commercial cultivar, does not always guarantee consistently high yields.…”

Evaluation of candidate F-box genes for the pollen S of gametophytic self-incompatibility in the Pyrinae (Rosaceae) on the basis of their phylogenomic context

“…For this, consensus primers-PycomC1F (5′ ATTTTCAATTTACGCAGCAATATCAGC 3′) and PycomC5R (5′ CTGCAAAGWSH GACCTCAACCAATTC 3′)-annealing at the C1 and C5 consensus conserved regions of the Pyrinae S-RNase were used for genomic DNA amplification according to Sanzol (2009a). PCR amplifications were cloned and sequenced as detailed in the following subsections.…”

Cloning and mapping multiple S-locus F-box genes in European pear (Pyrus communis L.)

“…S-genotypes of all the individuals of the progeny were determined by PCR using primers designed on the S-RNase gene, PycomC1F (5′-ATTTTCAATTTACGCAGCAATA TCAGC-3′) and PycomC5R (5′-CTGCAAAGWSHGACC TCAACCAATTC-3′) according with Sanzol (2009a); the amplified products were resolved using agarose gel electrophoresis.…”