Genomic suppression of murine B29/Ig‐β promoter‐driven transgenes

Abstract

Immunoglobulin b (Ig-b) is a critical signal transducer of precursor B cell and B cell receptors. B29, the gene coding for Ig-b, is switched on in progenitor B cells and expressed until the terminal stage of antibody-producing plasma cells. Although several cis-acting elements and transcription factors required for B29 expression have been characterized in cell lines, the in vivo significance of individual motifs located in the 1.2-kb promoter region remained unclear. To address whether this region drives B lineage-specific expression in mice as efficiently as in transfected cell lines, we established transgenic animals carrying the B29 promoter fused to either enhanced green fluorescent protein (EGFP) or the precursor B cell receptor component k5. Surprisingly, only minimal levels of B29-derived transcripts were produced in B lymphoid tissues of several independent transgenic lines, and the respective proteins were below the detection limit. In addition, transgenic transcripts were found in testis, kidney and brain. Hence, the 1.2-kb-sized B29 promoter does not define a strong, B lineage-restricted expression unit when randomly integrated into the genome and passed through the murine germ line. Therefore, yet unidentified genomic locus control elements are required to efficiently drive B29 expression in B lymphocytes.

A Unique Role for the λ5 Nonimmunoglobulin Tail in Early B Lymphocyte Development

“…BamHI-digested genomic DNA was analyzed as described (38) by Southern blotting with a 1687-bp-sized 5 probe amplified by PCR from genomic DNA (primers: AGTCAGCTAGCAAACTCCAAATATCTGT AAAATTCCAAAGCTTCT and TGACTGCTAGCCAGCACACAAACC TATAGTGCAAACAGGTCC) and labeled with [ 32 P]dCTP (RadPrime kit, Invitrogen). Radioactive bands were visualized with a FLA-3000 phosphoimager (Fujifilm) equipped with BASReader software (Raytest).…”

“…Single-cell suspensions were stained as previously described (38) with the following Abs: RPE-conjugated rat anti-CD19 (clone 1D3, BD Biosciences), rat anti-CD19 (clone 1D3F2) conjugated to Alexa Fluor 488 with a labeling kit (Molecular Probes/Invitrogen), RPE-conjugated rat …”