1998
DOI: 10.1161/01.atv.18.11.1803
|View full text |Cite
|
Sign up to set email alerts
|

Genotype-Specific Transcriptional Regulation of PAI-1 Gene by Insulin, Hypertriglyceridemic VLDL, and Lp(a) in Transfected, Cultured Human Endothelial Cells

Abstract: Abstract-Plasminogen activator inhibitor-1 (PAI-1) has been shown to be an independent risk factor for coronary artery disease. Variations in plasma PAI-1 levels have been attributed to variations in the PAI-1 gene, and associations between PAI-1 levels and PAI-1 genotypes suggest that PAI-1 expression may be regulated in a genotype-specific manner by insulin, hypertriglyceridemic (HTG) very low density lipoprotein (VLDL), or lipoprotein(a) [Lp(a)]. Polymerase chain reaction-amplified 1106-bp fragments of the … Show more

Help me understand this report

Search citation statements

Order By: Relevance

Paper Sections

Select...
2
1
1

Citation Types

0
16
0

Year Published

2000
2000
2023
2023

Publication Types

Select...
6
2
1

Relationship

2
7

Authors

Journals

citations
Cited by 31 publications
(16 citation statements)
references
References 61 publications
0
16
0
Order By: Relevance
“…Insulin or proinsulin infusion can cause local elevation of PAI-1 detected by analysis of PAI-1 protein levels (33)(34)(35) or by in situ hybridization (36). Insulin also increases expression of the endogenous PAI-1 gene in HepG2 cells (37) and the transcription of a luciferase reporter plasmid under control of the PAI-1 promoter in human umbilical vein endothelial cells (HUVEC) in culture (38,39). The insulin response element was suggested to be in the region Ϫ98/Ϫ62, but this was never confirmed by mutational analysis of the PAI-1 promoter (40).…”
Section: Pai-1mentioning
confidence: 99%
“…Insulin or proinsulin infusion can cause local elevation of PAI-1 detected by analysis of PAI-1 protein levels (33)(34)(35) or by in situ hybridization (36). Insulin also increases expression of the endogenous PAI-1 gene in HepG2 cells (37) and the transcription of a luciferase reporter plasmid under control of the PAI-1 promoter in human umbilical vein endothelial cells (HUVEC) in culture (38,39). The insulin response element was suggested to be in the region Ϫ98/Ϫ62, but this was never confirmed by mutational analysis of the PAI-1 promoter (40).…”
Section: Pai-1mentioning
confidence: 99%
“…In an endothelial cell system, native Lp(a), via apo(a), has been shown to stimulate the production of adhesion molecules such as intercellular adhesion molecule (11), vascular cell adhesion molecule-1 (12), and E-selectin (12), as well as endothelin-1 (13) and I-309, a potent chemoattractant for monocytes (14). Native Lp(a) has also been reported to enhance endothelial plasminogen activator inhibitor-1 expression (15,16), although those data have not been corroborated by other studies (13,17). Moreover, in a vascular smooth muscle cell system, native Lp(a), and particularly apo(a), was shown to inhibit the proteolytic activation of transforming factor ␤ via a decrease in cell surface generation of plasmin, resulting in increased vascular smooth muscle cells proliferation (18).…”
mentioning
confidence: 99%
“…39 The PCR was carried out with use of an upstream primer (5Ј CGATCGGTACCCCATTGTCACCTTATCAGCCTGCCC 3Ј) identical to positions 1473 to 1497 and downstream primer (5Ј GATCAGATCTTCCTCGCAGAGGTTTCTCTCCAGC 3Ј) complementary to positions 3692 to 3668 of the human tPA gene. 33 Both these primers had a CGATC clamp and a KpnI site in the upstream primer (underlined) and a BglII site in the downstream primer (underlined) to aid in the subsequent cloning into the luciferase reporter gene (luc, pGL3-basic expression vector, Promega Corp).…”
Section: Amplification 5 Promoter and Flanking Regions (ϸ2220-bp Fragmentioning
confidence: 99%
“…Detailed sequencing analyses were carried out with duplicate PCR clones from single PCR amplification of 8 individual (16 sequences) promoter fragments to rule out errors due to PCR cloning or sequencing, as described previously. 39 Sequencing was carried out on both strands by the UAB Automated DNA Sequencing Core Facility.…”
Section: Amplification 5 Promoter and Flanking Regions (ϸ2220-bp Fragmentioning
confidence: 99%