Global changes of the RNA-bound proteome during the maternal-to-zygotic transition in Drosophila

Abstract

The maternal-to-zygotic transition (MZT) is a process that occurs in animal embryos at the earliest developmental stages, during which maternally deposited mRNAs and other molecules are degraded and replaced by products of the zygotic genome. The zygotic genome is not activated immediately upon fertilization, and in the pre-MZT embryo post-transcriptional control by RNA-binding proteins (RBPs) orchestrates the first steps of development. To identify relevant Drosophila RBPs organism-wide, we refined the RNA interactome capture method for comparative analysis of the pre- and post-MZT embryos. We determine 523 proteins as high-confidence RBPs, half of which were not previously reported to bind RNA. Comparison of the RNA interactomes of pre- and post-MZT embryos reveals high dynamicity of the RNA-bound proteome during early development, and suggests active regulation of RNA binding of some RBPs. This resource provides unprecedented insight into the system of RBPs that govern the earliest steps of Drosophila development.

Specific RNP capture with antisense LNA/DNA mixmers

“…A current drawback of this method is the requirement of a poly(A) enrichment step and the reported limited enrichment of the target RNAs. As the noCL control was devoid of proteins and cCL/noCL ratios could not be estimated, a semiquantitative approach described in Sysoev et al (2016) was used to identify rRNAbinding proteins. Values in columns 2, 3, and 4 represent number (n) of protein identification across replicates.…”

“…Thus, the concentration of Sxl in the 0-12 h, mixed male/female embryo extract is very low, and Sxl appears to have been outcompeted by its ubiquitously expressed paralog Ssx. Sxl has previously been identified by mass spectrometry as a component of the D. melanogaster RNA interactome, but found to change during maternal-to-zygotic transition (Sysoev et al 2016). Thus, the lack of Sxl from the specifically captured RNP appears to have biological rather than technical reasons.…”

“…Ssx and Sxl are paralogs that arose from a gene duplication event (Traut et al 2006;Cline et al 2010). Ssx is highly homologous to Sxl, and was previously identified as an RBP without assigned binding targets (Sysoev et al 2016;Wessels et al 2016). The similarity between the two RBPs is especially high across the two RNA recognition motifs (RRMs) as well as in the glycine-rich region in the N terminus (52% identity; 72% similarity via LALIGN Readseq version 2.1.30).…”

“…RT-qPCR primers used (all from 5 ′ to 3 ′ ; f:forward; r:reverse): CAT: f:GCAAGATGTGGCGTGTTACG; r:AAAACGGGGGCGAA GAAGTT Primers for the quantification of human 18S rRNA and GAPDH (Castello et al 2012) and Drosophila melanogaster 18S rRNA and GAPDH (Sysoev et al 2016) and Rluc and Fluc (Sanchez et al 2007) were previously described.…”

“…Applied to HeLa and HEK293 cells, RNA interactome capture identified more than a thousand RBPs, hundreds of which were previously unknown to bind RNA. This method was successfully used to determine the poly(A)-RNA-binding proteome of different human cell types, including human (Baltz et al 2012;Castello et al 2012;Beckmann et al 2015) and murine (Kwon et al 2013;Liao et al 2016;Liepelt et al 2016) cells, as well as from organisms such as S. cerevisiae (Mitchell et al 2013;Beckmann et al 2015;Matia-González et al 2015), C. elegans (Matia-González et al 2015), D. melanogaster (Sysoev et al 2016;Wessels et al 2016), A. thaliana (Marondedze et al 2016;Reichel et al 2016), and the parasites plasmodium and trypanosoma (Bunnik et al 2016;Lueong et al 2016). However, the identification of the RBPs bound to specific RNAs remains challenging.…”