Glutathione contributes to plant defence against parasitic cyst nematodes

Abstract

Cyst nematodes (CNs) are an important group of root‐infecting sedentary endoparasites that severely damage many crop plants worldwide. An infective CN juvenile enters the host's roots and migrates towards the vascular cylinder, where it induces the formation of syncytial feeding cells, which nourish the CN throughout its parasitic stages. Here, we examined the role of glutathione (l‐γ‐glutamyl‐l‐cysteinyl‐glycine) in Arabidopsis thaliana on infection with the CN Heterodera schachtii. Arabidopsis lines with mutations pad2, cad2, or zir1 in the glutamate–cysteine ligase (GSH1) gene, which encodes the first enzyme in the glutathione biosynthetic pathway, displayed enhanced CN susceptibility, but susceptibility was reduced for rax1, another GSH1 allele. Biochemical analysis revealed differentially altered thiol levels in these mutants that was independent of nematode infection. All glutathione‐deficient mutants exhibited impaired activation of defence marker genes as well as genes for biosynthesis of the antimicrobial compound camalexin early in infection. Further analysis revealed a link between glutathione‐mediated plant resistance to CN infection and the production of camalexin on nematode infection. These results suggest that glutathione levels affect plant resistance to CN by fine‐tuning the balance between the cellular redox environment and the production of compounds related to defence against infection.

The Role of Ascorbate-Glutathione System and Volatiles Emitted by Insect-Damaged Lettuce Roots As Navigation Signals for Insect and Slug Parasitic Nematodes

“…Additionally, wireworm-infested roots had a significantly higher percentage of oxidized glutathione than the control group, and there was a trend towards higher levels of total glutathione in both the roots and leaves of infested plants. Similar results were found in previous studies [13,[41][42][43][44], where total glutathione levels increased in tissues at the feeding site of wheat plants after Hessian fly infestation and changes in glutathione peroxidase and glutathione transferase were found in leaves of Arabidopsis plants after infestation by Tetranycus urticae attack [41]. The role of glutathione in mediating the defense dialog during plant-wireworm interactions is not well understood, but this study provides evidence for its involvement.…”

Root architecture plasticity in response to endoparasitic cyst nematodes is mediated by damage signaling

“…Attention was paid not to include root tips and secondary root primordia. Subsequently, RNA extraction and qPCR were performed as previously described (Chopra et al ., 2021 ; Hasan et al ., 2022 ). ERF109 was amplified using the primers CTTATGATCGAGCCGCGATT and TCCTCCGTTCCATTGCTCTG (Cai et al ., 2014 ; Zhou et al ., 2019 ).…”

“…Relative expression of ERF109 was calculated based on the endogenous control 18 S rRNA (Pfaffl, 2001 ). The average ERF109 expression in the mock‐inoculated wild‐type roots of the first biological replicate was used as a reference to normalize the average expression in the other samples (Hasan et al ., 2022 ).…”

In Vitro Filaricidal Properties of Aqueous Extracts of Combretum nigricans (Combretaceae) on Onchocerca ochengi (Onchocercidae)

“…Aside from the rise in MDA, there was also an increase in GSH content. Previous research has found that decreased GSH levels affect the resilience of certain nematodes [ 63 ]. The increase in GSH could therefore be seen as an adaptive response put in place by the parasite to curb oxidative stress but which is not sufficient to compensate for stress already present.…”