Glutathione S-transferase genotypes as risk factors for head and neck cancer

Trizna, Zoltan; Clayman, Gary L.; Spitz, Margaret R.; Briggs, Katrina; Goepfert, Helmuth

doi:10.1016/s0002-9610(99)80339-0

Cited by 108 publications

(58 citation statements)

References 14 publications

Supporting

Mentioning

Contrasting

Unclassified

Order By: Relevance

“…Absence of GSTM1-specific product indicated homozygosity for the null allele. The GSTT1 genotype was determined according to the method of Pemble et al (1994) (Cheng et al, 1999;Jahnke et al, 1996;Jourenkova et al, 1998;Khuri et al, 1997;Park et al, 1997;Trizna et al, 1995). In this study we found no association between GSTM1 nullizygosity and SCCHN.…”

supporting

confidence: 38%

Increased risk of head and neck cancer in association with GSTT1 nullizygosity for individuals with low exposure to tobacco

Hamel¹,

Karimi²,

Hébert‐Blouin³

et al. 2000

Int. J. Cancer

View full text Add to dashboard Cite

Increased risk of head and neck cancer in association with GSTT1 nullizygosity for individuals with low exposure to tobacco Tobacco and alcohol are important contributing factors to the development of squamous cell carcinoma of the head and neck (SCCHN) (Blot et al., 1988;Vokes et al., 1993). However, recent case-control studies indicate that SCCHN is also associated with a family history of this cancer (Copper et al., 1995;Foulkes et al., 1995Foulkes et al., , 1996. In addition, second primary tumors, which are often a hallmark of inherited susceptibility to cancer, occur in up to 30% of patients with SCCHN (Day and Blot, 1992;Jones et al., 1995). A family history of SCCHN is more common for these cases than for single primary cases (Bongers et al., 1995;Foulkes et al., 1996) and it has been reported that non-smoking SCCHN patients are significantly more likely to be mutagen-sensitive than current smokers . It is, therefore, reasonable to suspect a role for inherited factors in determining predisposition to SCCHN. Since large pedigrees with numerous cases of SCCHN are uncommon (Foulkes et al., 1996), genetic susceptibility to SCCHN is likely to be conferred by cancer genes of low penetrance.We and others (Vineis et al., 1994;Foulkes et al., 1996) All cases and controls were genotyped for presence or absence of both the GSTT1 and GSTM1 genes. Genotyping of GSTM1 was performed on genomic DNA by PCR amplification as previously described using three primers that amplify the GSTM1 sequence and a second internal control sequence simultaneously (Zhong et al.,1993). Absence of GSTM1-specific product indicated homozygosity for the null allele. The GSTT1 genotype was determined according to the method of Pemble et al. (1994) modified to incorporate the simultaneous amplification of partial ␤-globin sequences to serve as an internal control . As in the case of GSTM1, the absence of a GSTT1-specific product was indicative of homozygosity for the null allele.We observed 70 GSTT1 positives and 9 GSTT1 nulls in cases, compared with 81 positives and 20 nulls in controls (OR ϭ 2.57, p ϭ 0.04

show abstract

supporting

confidence: 38%

Increased risk of head and neck cancer in association with GSTT1 nullizygosity for individuals with low exposure to tobacco

Hamel¹,

Karimi²,

Hébert‐Blouin³

et al. 2000

Int. J. Cancer

View full text Add to dashboard Cite

show abstract

“…Some of these studies suggested that there was the lack of association between the GSTM1 gene polymorphism and the development of laryngeal cancer and head and neck cancer [22][23][24] whereas, another study showed that the GSTM1 null genotype is a risk factor for development of laryngeal cancer [5]. Differences in the results of the previous studies may due to different samples analyzed for the polymorphism studies such as using lymphocytes [22,25] or tissue samples [26]. Our results show that the null genotype of GSTM1 was not found to be associated with development of laryngeal cancer.…”

Section: Discussionmentioning

confidence: 99%

Relationship of tobacco smoking with GSTM1 gene polymorphism in laringeal cancer

Bardakçı

Canbay

Değerli

et al. 2003

J Cellular Molecular Medi

View full text Add to dashboard Cite

This paper aimed to analyze the association of polymorphism of GSTM1 0/0 genotype with laryngeal cancer along a hospital based case‐control study. Polymorphisms of GSTM1 0/0 of samples from 36 patients with laryngeal cancer and 35 healthy controls were detected by PCR method. The reaction used as GSTM1 primers, using the sequence sense: 5′‐CTGCCCTACTTGGATTGATGGG‐3′ and antisense: 5′‐TGGATTGTAGCAGATCATGC‐3′. N Acetyl transferase 1 (NAT1) gene using the primers sense: 5′‐TAAAAGTAAAATGATTTGCTTTCG‐3′ and antisense: 5′‐GCTTTCTAGCATAAATCACCAA‐3′ was used as internal positive control. Two sided 2 and multivariation analysis were used to analyse the results. The proportions of GSTM1 deleted genotype in cases and controls were 47.2% and 54.3%, respectively. There was significant increment of GSTM 0/0 genotype frequency in moderate smokers group of patients compared to control (P=0.033, OR= 4.78, 95% CI=1.30‐7.13). We conclude that GSTM1 deleted genotype may be a genetic susceptibility marker for laryngeal cancer whose exposed to low doses carcinogens. The absence of this enzyme seems to have a role in the development of laryngeal cancer, in which the mechanism still needs further investigation.

show abstract

“…However, not everyone exposed to these agents develops oral squamous cell carcinoma (OSCC). The apparent inter-individual differences in susceptibility to carcinogenic exposures may result from differences in the interaction of genetic and environmental factors (Rogers et al, 1993;Goldstein et al, 1994;Foulkes et al, 1995Foulkes et al, , 1996Trizna et al, 1995;Bongers et al, 1996;Cloos et al, 1996;Park et al, 1997). Several studies have also reported gender and racial differences in OSCC susceptibility (Day et al, 1993;Muscat et al, 1996).…”

Section: Periodontal Diseasesmentioning

confidence: 99%

“…Functional polymorphisms have been identified at both the genotypic and the phenotypic levels in a variety of xenobiotic metabolizing enzymes, and polymorphisms that confer differential abilities to cope with pharmacologic and carcinogenic metabolites have been identified in the phase I and phase II xenobiotic metabolizing enzymes. Analysis of data from several studies suggests a significant relationship between the presence of certain genetically determined enzyme isoforms and relative risk for OSCC (Trizna et al, 1995;Park et al, 1997;Gonzalez et al, 1998). Such findings may explain why certain individuals are at increased risk for OSCC.…”

Section: Periodontal Diseasesmentioning

confidence: 99%

The Impact of Molecular Genetics on Oral Health Paradigms

Hart

Marazita

Wright

2000

Critical Reviews in Oral Biology & Medicine

View full text Add to dashboard Cite

As a result of our increased understanding of the human genome, and the functional interrelationships of gene products with each other and with the environment, it is becoming increasingly evident that many human diseases are influenced by heritable alterations in the structure or function of genes. Significant advances in research methods and newly emerging partnerships between private and public sector interests are creating new possibilities for utilization of genetic information for the diagnosis and treatment of human diseases. The availability and application of genetic information to the understanding of normal and abnormal human growth and development are fundamentally changing the way we approach the study of human diseases. As a result, the issues and principles of medical genetics are coming to bear across all disciplines of health care. In this review, we discuss some of the potential applications of human molecular genetics for the diagnosis and treatment of oral diseases. This discussion is presented in the context of the ongoing technological advances and conceptual changes that are occurring in the field of medical genetics. To realize the promise of this new molecular genetics, we must be prepared to foresee the possibilities and to incorporate these newly emergent technologies into the evolving discipline of dentistry. By using examples of human conditions, we illustrate the broad application of this emerging technology to the study of simple as well as complex genetic diseases. Throughout this paper, we will use the following terminology: Penetrance In a population, defined as the proportion of individuals posessing a disease-causing genotype who express the disease phenotype. When this proportion is less than 100%, the disease is said to have reduced or incomplete penetrance. Polymerase chain reaction (PCR)-A technique for amplifying a large number of copies of a specific DNA sequence flanked by two oligonucleotide primers. The DNA is alternately heated and cooled in the presence of DNA polymerase and free nucleotides, so that the specified DNA segment is denatured, hybridized with primers, and extended by DNA polymerase. MIM-Mendelian Inheritance in Man catalogue number from V. McKusick's Mendelian Inheritance in man (OMIM, 1998).

show abstract

Glutathione S-transferase genotypes as risk factors for head and neck cancer

Cited by 108 publications

References 14 publications

Increased risk of head and neck cancer in association with GSTT1 nullizygosity for individuals with low exposure to tobacco

Increased risk of head and neck cancer in association with GSTT1 nullizygosity for individuals with low exposure to tobacco

Relationship of tobacco smoking with GSTM1 gene polymorphism in laringeal cancer

The Impact of Molecular Genetics on Oral Health Paradigms

Contact Info

Product

Resources

About