Growth hormone and erythropoietin differentially activate DNA-binding proteins by tyrosine phosphorylation.

Abstract

Binding of growth hormone (GH) and erythropoietin (EPO) to their respective receptors results in receptor clustering and activation of tyrosine kinases that initiate a cascade of events resulting not only in the rapid tyrosine phosphorylation of several proteins but also in the induction of early-response genes. In this report, we show that GH and EPO induce the tyrosine phosphorylation of cellular proteins with molecular masses of 93 kDa and of 91 and 84 kDa, respectively, and that these proteins form DNA-binding complexes which recognize an enhancer that has features in common with several rapidly induced genes such as c-fos. Assembly of the protein complexes required tyrosine phosphorylation, which occurred within minutes after addition of ligand. The activated complexes translocated from the cytoplasm to the nucleus. The protein activated by GH is antigenically similar to p91, a protein common to several transcription complexes that are activated by interferons and other cytokines. In contrast, the proteins activated by EPO are distinct from p91. These findings establish the outlines for a cytokine-induced intracellular signaling pathway, which begins with ligand-induced receptor clustering that activates one or more tyrosine kinases. These data are the first to demonstrate that GH-and EPO-activated tyrosine-phosphorylated proteins can specifically recognize a well-defined enhancer and therefore provide a mechanism for rapidly transducing signals from the membrane to the nucleus.

Threading analysis suggests that the obese gene product may be a helical cytokine

“…In response to GHR aggregation and binding of JAK2 to the cytoplasmic domain of GHR, a variety of tyrosine phosphorylation reactions occur, including autophosphorylation of JAK2, phosphorylation of the GHR cytoplasmic domain, and phosphorylation of other cellular substrates that come to be associated with the GHR JAK2 complex. These other kinase substrates have recently been shown to be protein transcription factors known as STATs (signal transducers and activators of transcription), specifically STAT1 and STAT3 [33,34,35,36]. These STATs activate transcription of several genes including c-fos and insulin-like growth factor I [37].…”

Differential Regulation of the Alpha/Beta Interferon-Stimulated Jak/Stat Pathway by the SH2 Domain-Containing Tyrosine Phosphatase SHPTP1

“…Electrophoretic mobility shift assays (EMSAs) were performed as previously described, using whole cell extracts prepared with Triton X-100-containing buffers as described above (10,20,48). Probes, consisting of the GRR found within the promoter of the Fc␥RI gene (5Ј AGCATGTTTCAAGGATT TGAGATGTATTTCCCAGAAAAG 3Ј) and the ISRE of IFN-stimulated gene 15 (5Ј GATCCATGCCTCGGGAAAGGGAAACCGAAACTGAAGCC 3Ј) were end labeled by using polynucleotide kinase and [␥- (20).…”

Yin-yang 1 and Glucocorticoid Receptor Participate in the Stat5-mediated Growth Hormone Response of the Serine Protease Inhibitor 2.1 Gene

“…We delineated a GH response element (GHRE) in the promoter of Spi 2.1 that includes two ␥-activated sites (GAS), both of which are necessary for a GH response in functional assays (15). In the hypophysectomized rat, as well as in several cell lines, GH activates Stat1, -3, and/or -5 (7)(8)(9)(10)(15)(16)(17)(18)(19). Stat5, first purified as the prolactin (PRL)-responsive mammary gland factor from sheep mammary glands (20), has since been purified and cloned from mouse liver and IM-9 lymphocytes (19,21).…”