Growth inhibition of Fusarium solani and F. oxysporum by Streptomyces sasae TG01, and its ability to solubilize insoluble phosphate

Abstract

Abstract. Sudiana A, Putri A, Napitupulu TP, Purnaningsih I, Idris, Kanti A. 2020. Growth inhibition of Fusarium solani and F. oxysporum by Streptomyces sasae TG01, and its ability to solubilize insoluble phosphate. Biodiversitas 21: 429-435. Actinomycetes have been widely explored for new antibiotic production, but not many studies explore its abilities to inhibit the growth of phytopathogenic fungi and solubilize insoluble phosphate hence stimulate the growth of plants. We isolated Actinomycetes from the soil. Based on morphology, physiology, and 16S rDNA analyses, the isolate is closely related to Streptomyces sasae. The strain was able to inhibit the growth of phytopathogenic fungi Fusarium solani, and Fusarium oxysporum. S. sasae produced secondary metabolites 2-methyl-1,3-dioxolane as the major constituent. The strain assimilated variable carbon sources include L-arabinose, D-fructose, D-glucose, D-mannitol, Lactose, raffinose, L-rhamnose, and sucrose. The strain grew at pH 6.0 to 8.0, and at salinity (1-3%). Their growth was affected by the salinity level. The strain solubilized Ca-P at 1-3% salinity, but their ability to solubilize phosphate was influenced by salinity. The strain was also able to solubilize rock phosphate. Their ability to solubilize less soluble phosphate and inhibit the growth of F. solani and F. oxysporum may imply that this strain is potential for biocontrol agents. The 16S rRNA gene was submitted to DDBJ with the entry number 5df623c1a3c8820021322a36.TG01, and the accession number is LC514451.

Identification of antagonistic Streptomyces strains isolated from Algerian Saharan soils and their plant growth promoting properties

“…The proportion of active isolates against V. dahlia, recorded in this study, was higher than that obtained by Xue et al (2013). Also, recent studies (Sharma and Manhas 2020;Sudiana et al 2020) have found that F. oxysporum was also sensitive to antagonistic actinobacteria isolated from soil. Genera associated with the selected isolates Morphological and physiological traits are summarized in Table 2.…”

“…Which have shown their efficiency in improving the accessibility of phosphate to plants by laboratory, greenhouse, or field trials (Salcedo et al 2014). Nevertheless, actinobacteria have been extensively studied for their capacity to produce new antibiotics, but few studies have explored their aptitude to solubilize phosphate (Sudiana et al 2020). In this study, a qualitative assessment of phosphate solubilization showed the apparition of a clear solubilization zone around colonies of S. flaveus SO1 and S. enissocaesilis SO2.…”

“…Genomic DNA was extracted and purified as described by Franco-Correa et al (2010). The amplification primers were F27 [5'AGAGTTTGATCCTGGCTCAG3'] and R1492 [5'TACGGCTACCTTGTTACGACTT3'] (Aouar et al 2012;Sudiana et al 2020). PCR conditions were 5 min of predenaturation at 95 °C; and then 35 cycles including 1 min of denaturation at 95 °C, 1 min of annealing at 50 °C, and 2 min of extension at 72 °C.…”

The Efficacy of Functional Composts Manufactured Using Spent Coffee Ground, Rice Bran, Biochar, and Functional Microorganisms

“…lycopersici, digesting the fungal cell wall composed of chitin [51]. Streptomyces sasae TG01 can inhibit the growth of phytopathogenic fungi Fusarium solani and Fusarium oxysporum by producing secondary metabolites including 2-methyl-1,3-dioxolane as the major constituent [52]. The two most effective bioactive root symbiont Streptomyces strains (H2 and H3) were selected based on in vitro petri plate seedling bioassays (IPSB), effectively controlling the damping-off disease caused by Pythium aphanidermatum as well as behaving as plant growth-promoting rhizobacteria able to increase the fresh and dry weight of tomato plants [53].…”

Antagonism and plant growth promoting traits of actinomycetes isolated from the rhizosphere of halophyte Atriplex halimus L.

“…Field crops production is affected by plant diseases, fungi are the main cause of damage and quality degradation of harvested products. In this regard, a range of fungal species cause diseases that affect all parts of the plants, including F. oxysporum and F. solani, which are considered as the causal of plant wilting diseases (Sudiana et al, 2020). On the other hand, B. cinerea is one of the most widespread phytopathogenic fungi, it causes a gray mold disease that affects many crops (De Angelis et al, 2022).…”