Growth promotion and disease resistance induced in Anthurium colonized by the beneficial root endophyte Piriformospora indica

Lin, Hui‐Yi; Xiong, Jie; Zhou, Hui‐Ming; Chen, Changming; Lin, Fazhuang; Xu, Xuming; Oelmüller, Ralf; Xu, Weifeng; Yeh, Kai‐Wun

doi:10.1186/s12870-019-1649-6

Cited by 47 publications

(26 citation statements)

References 52 publications

Supporting

Mentioning

Contrasting

Unclassified

Order By: Relevance

“…Total and soluble Pi measurements were performed as described earlier (Mehra et al 2019 ). Jasmonic acid levels were measured in root tissues as described previously (Lin et al 2019 ). Briefly, 100 mg of roots was weighed and frozen immediately in liquid nitrogen.…”

Section: Methodsmentioning

confidence: 99%

OsJAZ11 regulates phosphate starvation responses in rice

Pandey

Verma

Prusty

et al. 2021

Planta

View full text Add to dashboard Cite

Main conclusion OsJAZ11 regulates phosphate homeostasis by suppressing jasmonic acid signaling and biosynthesis in rice roots. Abstract Jasmonic Acid (JA) is a key plant signaling molecule which negatively regulates growth processes including root elongation. JAZ (JASMONATE ZIM-DOMAIN) proteins function as transcriptional repressors of JA signaling. Therefore, targeting JA signaling by deploying JAZ repressors may enhance root length in crops. In this study, we overexpressed JAZ repressor OsJAZ11 in rice to alleviate the root growth inhibitory action of JA. OsJAZ11 is a low phosphate (Pi) responsive gene which is transcriptionally regulated by OsPHR2. We report that OsJAZ11 overexpression promoted primary and seminal root elongation which enhanced Pi foraging. Expression studies revealed that overexpression of OsJAZ11 also reduced Pi starvation response (PSR) under Pi limiting conditions. Moreover, OsJAZ11 overexpression also suppressed JA signaling and biosynthesis as compared to wild type (WT). We further demonstrated that the C-terminal region of OsJAZ11 was crucial for stimulating root elongation in overexpression lines. Rice transgenics overexpressing truncated OsJAZ11ΔC transgene (i.e., missing C-terminal region) exhibited reduced root length and Pi uptake. Interestingly, OsJAZ11 also regulates Pi homeostasis via physical interaction with a key Pi sensing protein, OsSPX1. Our study highlights the functional connections between JA and Pi signaling and reveals JAZ repressors as a promising candidate for improving low Pi tolerance of elite rice genotypes.

show abstract

Section: Methodsmentioning

confidence: 99%

OsJAZ11 regulates phosphate starvation responses in rice

Pandey

Verma

Prusty

et al. 2021

Planta

View full text Add to dashboard Cite

show abstract

“…To assess whether P. indica had performed successful colonisation of onion roots by P. indica , roots of 10 randomly selected P. indica -treated plants were harvested at 45 days post-treatment and incubated at 90 °C in 10% KOH for 3 min, followed by 1 min in 1 N HCl, before staining with trypan blue (0.02%) for 60 min at room temperature. Root colonisation was observed under a DM2500 light microscope (Leica Microsystems, Wetzlar, Germany), and further confirmed by RT-PCR analysis carried out according to Lin et al (2019) with P. indica specific primer pair Tef F (5′ TCCGTCGCGCACCATT 3′) and Tef R (5′ AAATCGCCCTCTTTCCACAA 3′), designed within the Pitef1 gene coding for the transcription elongation factor 1α [ 136 ].…”

Section: Methodsmentioning

confidence: 99%

Piriformospora indica Primes Onion Response against Stemphylium Leaf Blight Disease

et al. 2021

View full text Add to dashboard Cite

The root-endophytic fungus Piriformospora indica (=Serendipita indica) has been revealed for its growth-promoting effects and its capacity to induce resistance in a broad spectrum of host plants. However, the bioefficacy of this fungus had not yet been tested against any pathogen affecting onion (Allium cepa). In this study, the biocontrol potency of P. indica against onion leaf blight, an impacting disease caused by the necrotrophic fungal pathogen Stemphylium vesicarium, was evaluated. First, it was proved that colonisation of onion roots by P. indica was beneficial for plant growth, as it increased leaf development and root biomass. Most relevantly, P. indica was also effective in reducing Stemphylium leaf blight (SLB) severity, as assessed under greenhouse conditions and confirmed in field trials in two consecutive years. These investigations could also provide some insight into the biochemical and molecular changes that treatment with P. indica induces in the main pathways associated with host defence response. It was possible to highlight the protective effect of P. indica colonisation against peroxidative damage, and its role in signalling oxidative stress, by assessing changes in malondialdehyde and H2O2 content. It was also showed that treatment with P. indica contributes to modulate the enzymatic activity of superoxide dismutase, catalase, phenylalanine ammonia-lyase and peroxidase, in the course of infection. qPCR-based expression analysis of defence-related genes AcLOX1, AcLOX2, AcPAL1, AcGST, AcCHI, AcWRKY1, and AcWRKY70 provided further indications on P. indica ability to induce onion systemic response. Based on the evidence gathered, this study aims to propose P. indica application as a sustainable tool for improving SLB control, which might not only enhance onion growth performance but also activate defence signalling mechanisms more effectively, involving different pathways.

show abstract

“…Piriformospora indica Solanum lycopersicum Meloidogyne incognita [198] Piriformospora indica Glycine max Heterodera glycines [199] Piriformospora indica Anthurium andraeanum - [200] Phialemonium inflatum Gossypium sp.…”

Section: Nematodesmentioning

confidence: 99%

Endophytic Fungi: Biological Control and Induced Resistance to Phytopathogens and Abiotic Stresses

et al. 2021

View full text Add to dashboard Cite

Plant diseases cause losses of approximately 16% globally. Thus, management measures must be implemented to mitigate losses and guarantee food production. In addition to traditional management measures, induced resistance and biological control have gained ground in agriculture due to their enormous potential. Endophytic fungi internally colonize plant tissues and have the potential to act as control agents, such as biological agents or elicitors in the process of induced resistance and in attenuating abiotic stresses. In this review, we list the mode of action of this group of microorganisms which can act in controlling plant diseases and describe several examples in which endophytes were able to reduce the damage caused by pathogens and adverse conditions. This is due to their arsenal of molecules generated during the interaction by which they form a kind of biological shield in the plant. Furthermore, considering that endophytic fungi can be an important tool in managing for biotic and abiotic stresses due to the large amount of biologically active substances produced, bioprospecting this class of microorganisms is tending to increase and generate valuable products for agriculture.

show abstract

Growth promotion and disease resistance induced in Anthurium colonized by the beneficial root endophyte Piriformospora indica

Cited by 47 publications

References 52 publications

OsJAZ11 regulates phosphate starvation responses in rice

OsJAZ11 regulates phosphate starvation responses in rice

Piriformospora indica Primes Onion Response against Stemphylium Leaf Blight Disease

Endophytic Fungi: Biological Control and Induced Resistance to Phytopathogens and Abiotic Stresses

Contact Info

Product

Resources

About