Guidelines for the minimum evaluation of the performance of full-scale waste stabilization pond systems

Pearson, H. W.; Mara, D. D.; Bartone, Carl R.

doi:10.1016/0043-1354(87)90028-5

Cited by 74 publications

(37 citation statements)

References 1 publication

Supporting

Mentioning

Contrasting

Unclassified

Order By: Relevance

“…With the major exception of the optical water quality variables, the above recommendations are similar to those of Pearson et al (1987). These authors suggested that lagoon influent should be analysed (flow-weighted 24-h composite samples), as well as effluent so as to define the loading to the lagoon and permit calculation of lagoon treatment efficiency (i.e., proportion of different constituents removed).…”

Section: Implications For Monitoringmentioning

confidence: 90%

“…Using reasonable parameter values, with A" d (PAR) =13 rrr 1 , yields a critical depth of about 0.9 m, suggesting that algae in lagoons of 1.2 m average depth will indeed be light-limited. Motile algae, such as Euglena and Chlamydomonas that can optimise their position (and thus light environment) in the water column, are often abundant in lagoons (e.g., Haughey 1968;Robb 1974;Cassie 1983;Irving & Dromgoole 1986b;Pearson et al 1987;Wrigley & Torien 1990), which is further evidence for frequent light limitation. The restricted light penetration into lagoon waters also has implications for lagoon thermal behaviour, affecting depth of temporary stratification and response to wind mixing events.…”

Section: Optical Characteristicsmentioning

confidence: 99%

See 1 more Smart Citation

Organic matter, nutrients, and optical characteristics of sewage lagoon effluents

Davies‐Colley

Hickey

Quinn

1995

New Zealand Journal of Marine and Freshwater Research

View full text Add to dashboard Cite

The effluent characteristics of 11 domestic sewage waste stabilisation lagoons designed to national specifications were examined, with emphasis on their optical properties, biochemically active constituents, and receiving water impacts. Measurements of 26 variables were analysed and compared with our previous (1989) survey of lagoon effluent quality in New Zealand. There was considerable variation in effluent composition of the lagoons, although seasonality was not marked (< 3-fold change between summer and winter). The filterable proportion of total BOD5 appeared to be a useful indicator of lagoon performance. Nutrient levels in lagoon waters were high (overall medians were 5.1 g m -3 for dissolved reactive phosphorus and 10.5 g m -3 for dissolved inorganic nitrogen). The concentration of ammoniacal-N, which comprised most of the dissolved inorganic nitrogen, was highly variable (ratio of 95 to 5 percentile = 1900); this is of concern as a toxicant both to algae within lagoons and to aquatic life in receiving streams. Aquatic humus and algal biomass both contribute to the restricted light penetration (median euphotic depth -0.35 m) into lagoon waters (typically 1.2 m depth), apparently resulting in frequent light limitation of algal photosynthesis. Pond effluent character seems to be influenced strongly by sunlight and wind, via their effects on lagoon solids (largely algal biomass and associated detritus). M94020 Received 23 June 1994; accepted 1 February 1995Dilution of lagoon effluents by 40-fold would ensure that receiving streams meet existing guidelines for most attributes of concern, but > 100-fold dilution may be required to prevent visual clarity impacts, and several hundred-fold dilution to prevent benthic algal proliferations.

show abstract

Section: Implications For Monitoringmentioning

confidence: 90%

Section: Optical Characteristicsmentioning

confidence: 99%

Organic matter, nutrients, and optical characteristics of sewage lagoon effluents

Davies‐Colley

Hickey

Quinn

1995

New Zealand Journal of Marine and Freshwater Research

View full text Add to dashboard Cite

show abstract

“…According to previous guidelines of Pearson et al [44], and Mara and Pearson [45], DO was identified as an additional parameter for effluent quality monitoring and evaluation of pond performance, as it is determined not necessary to monitor this extra parameter for routine monitoring and evaluation. Nevertheless, this is totally not the case in conventional biological WWTPs using activated sludge.…”

Section: Insights For Oxygen Regulation In Wspsmentioning

confidence: 99%

A Closer Look on Spatiotemporal Variations of Dissolved Oxygen in Waste Stabilization Ponds Using Mixed Models

Pham

Echelpoel

et al. 2018

Water

View full text Add to dashboard Cite

Dissolved oxygen is an essential controlling factor in the performance of facultative and maturation ponds since both take many advantages of algal photosynthetic oxygenation. The rate of this photosynthesis strongly depends on the time during the day and the location in a pond system, whose roles have been overlooked in previous guidelines of pond operation and maintenance (O&M). To elucidate these influences, a linear mixed effect model (LMM) was built on the data collected from three intensive sampling campaigns in a waste stabilization pond in Cuenca, Ecuador. Within two parallel lines of facultative and maturation ponds, nine locations were sampled at two depths in each pond. In general, the output of the mixed model indicated high spatial autocorrelations of data and wide spatiotemporal variations of the oxygen level among and within the ponds. Particularly, different ponds showed different patterns of oxygen dynamics, which were associated with many factors including flow behavior, sludge accumulation, algal distribution, influent fluctuation, and pond function. Moreover, a substantial temporal change in the oxygen level between day and night, from zero to above 20 mg O 2 ·L −1 , was observed. Algal photosynthetic activity appeared to be the main reason for these variations in the model, as it was facilitated by intensive solar radiation at high altitude. Since these diurnal and spatial patterns can supply a large amount of useful information on pond performance, insightful recommendations on dissolved oxygen (DO) monitoring and regulations were delivered. More importantly, as a mixed model showed high predictive performance, i.e., high goodness-of-fit (R 2 of 0.94), low values of mean absolute error, we recommended this advanced statistical technique as an effective tool for dealing with high autocorrelation of data in pond systems.

show abstract

“…Additionally, a weekly sampling for performance indicators was carried out by determining on site temperature, DO and pH and collecting samples from the M1 influent, water column and effluent. These samples were analyzed for BOD 5 and filtered BOD 5 (5210 B), chlorophyll a (Pearson et al, 1987) and SS, TKN, filtered TKN, ammonia, nitrate and nitrate, as described previously. a PCR conditions as reference using 39 cycles during the annealing step * the forward primer contained the following GC-clamp in DGGE; CCGCCGCGCGGCGGGCGGGGCGGGGGCACGGGGG For molecular microbiological analyses, representative samples for winter conditions were collected for molecular analysis from the sludge layer and the M1 water column (at 0.10, 0.45 and 0.85 m depths); they were preserved with absolute ethanol (1:1 v/v) and stored at -20ºC in the laboratory before being processed.…”

Section: Tracer Experiments Withmentioning

confidence: 99%

Nitrification–denitrification in waste stabilisation ponds: a mechanism for permanent nitrogen removal in maturation ponds

Camargo‐Valero

Read

Mara

et al. 2010

Water Science and Technology

View full text Add to dashboard Cite

N showed that nitrification could be considered as an intermediate step in WSP, which is masked by simultaneous denitrification, under conditions of low algal activity. Molecular microbiology analysis showed that denitrification can be considered a feasible mechanism for permanent nitrogen removal in WSP, which may be supported either by ammonia-oxidising bacteria (AOB) or by methanotrophs, in addition to nitrite-oxidising bacteria (NOB). However, the relative supremacy of the denitrification process over other nitrogen removal mechanisms (e.g., biological uptake) depends upon phytoplanktonic activity.

show abstract

Guidelines for the minimum evaluation of the performance of full-scale waste stabilization pond systems

Cited by 74 publications

References 1 publication

Organic matter, nutrients, and optical characteristics of sewage lagoon effluents

Organic matter, nutrients, and optical characteristics of sewage lagoon effluents

A Closer Look on Spatiotemporal Variations of Dissolved Oxygen in Waste Stabilization Ponds Using Mixed Models

Nitrification–denitrification in waste stabilisation ponds: a mechanism for permanent nitrogen removal in maturation ponds

Contact Info

Product

Resources

About