“Half of the Sites” Binding ofd-Glyceraldehyde-3-phosphate Dehydrogenase Folding Intermediate with GroEL

We showed previously that the interaction of an ␣␤ heterodimeric intermediate with GroEL/GroES is essential for efficient ␣ 2 ␤ 2 assembly of human mitochondrial branched-chain ␣-ketoacid dehydrogenase. In the present study, we further characterized the mode of interaction between the chaperonins and the native-like ␣␤ heterodimer. The ␣␤ heterodimer, as an intact entity, was found to bind to GroEL at a 1:1 stoichiometry with a K D of 1.1 ؋ 10 ؊7 M. The 1:1 molar ratio of the GroEL-␣␤ complex was confirmed by the ability of the complex to bind a stoichiometric amount of denatured lysozyme in the trans cavity. Surprisingly, in the presence of Mg-ADP, GroES was able to cap the GroEL-␣␤ complex in cis, despite the size of 86 kDa of the heterodimer (with a His 6 tag and a linker). Incubation of the GroEL-␣␤ complex with Mg-ATP, but not AMP-PNP, resulted in the release of ␣ monomers. In the presence of Mg-ATP, the ␤ subunit was also released but was unable to assemble with the ␣ subunit, and rebound to GroEL. The apparent differential subunit release from GroEL is explained, in part, by the significantly higher binding affinity of the ␤ subunit (K D < 4.15 ؋ 10 ؊9 M) than the ␣ (K D ‫؍‬ 1.6 ؋ 10 ؊8 M) for GroEL. Incubation of the GroEL-␣␤ complex with Mg-ATP and GroES resulted in dissociation and discharge of both the ␣ and ␤ subunits from GroEL. The ␤ subunit upon binding to GroEL underwent further folding in the cis cavity sequestered by GroES. This step rendered the ␤ subunit competent for reassociation with the soluble ␣ subunit to produce a new heterodimer. We propose that this mechanism is responsible for the iterative annealing of the kinetically trapped heterodimeric intermediate, leading to an efficient ␣ 2 ␤ 2 assembly of human branched-chain ␣-ketoacid dehydrogenase.

Section: Discussionsupporting

confidence: 60%

Section: Discussionsupporting

confidence: 60%

Interactions of GroEL/GroES with a Heterodimeric Intermediate during α2β2 Assembly of Mitochondrial Branched-chain α-Ketoacid Dehydrogenase

Song¹,

Wynn²,

Chuang³

2000

“…Several previous studies have already described that GroEL can bind substrate proteins on both sides of the rings (21,22,(31)(32)(33). ATP-dependent GroES binding to one of the GroEL rings triggers the encapsulation of one of the substrates in the cis-cavity (22,23).…”

Section: Discussionmentioning

confidence: 99%

Revisiting the GroEL-GroES Reaction Cycle via the Symmetric Intermediate Implied by Novel Aspects of the GroEL(D398A) Mutant

Koike-Takeshita

Yoshida

Taguchi

2008

The Escherichia coli chaperonin GroEL is a double-ring chaperone that assists in protein folding with the aid of GroES and ATP. It is believed that GroEL alternates the folding-active rings and that the substrate protein (and GroES) can bind to the open trans-ring only after ATP in the cis-ring is hydrolyzed. However, we found that a substrate protein prebound to the trans-ring remained bound during the first ATP cycle, and this substrate was assisted by GroEL-GroES when the second cycle began. Moreover, a slow ATP-hydrolyzing GroEL mutant (D398A) in the ATP-bound form bound a substrate protein and GroES to the trans-ring. The apparent discrepancy with the results from an earlier study (Rye, H. S., Roseman, A. M., Chen, S., Furtak, K., Fenton, W. A., Saibil, H. R., and Horwich, A. L. (1999) Cell 97, 325-338) can be explained by the previously unnoticed fact that the ATP-bound form of the D398A mutant exists as a symmetric 1:2 GroEL-GroES complex (the "football"-shaped complex) and that the substrate protein (and GroES) in the medium is incorporated into the complex only after the slow turnover. In light of these results, the current model of the GroELGroES reaction cycle via the asymmetric 1:1 GroEL-GroES complex deserves reexamination.

“…The sequences of the primers were 5Ј ACTTCACTTCTAATGATGAT 3Ј(exon-10F1) and 5Ј AAAA-CATCTAGGTATCCAA 3Ј(exon-11R). Two primers specific for GAPDH were used as controls for each sample (42). RT-PCR was performed as instructed by manufacturer.…”

Section: Methodsmentioning

confidence: 99%

Efficient Intracellular Processing of the Endogenous Cystic Fibrosis Transmembrane Conductance Regulator in Epithelial Cell Lines

Varga

Jurkuvenaite

Wakefield³

et al. 2004

122

117

The cystic fibrosis transmembrane conductance regulator (CFTR) is a cAMP-dependent protein kinase A-activated chloride channel that resides on the apical surface of epithelial cells. One unusual feature of this protein is that during biogenesis, ϳ75% of wild type CFTR is degraded by the endoplasmic reticulum (ER)-associated degradative (ERAD) pathway. Examining the biogenesis and structural instability of the molecule has been technically challenging due to the limited amount of CFTR expressed in epithelia. Consequently, investigators have employed heterologous overexpression systems. Based on recent results that epithelial specific factors regulate both CFTR biogenesis and function, we hypothesized that CFTR biogenesis in endogenous CFTR expressing epithelial cells may be more efficient. To test this, we compared CFTR biogenesis in two epithelial cell lines endogenously expressing CFTR (Calu-3 and T84) with two heterologous expression systems (COS-7 and HeLa). Consistent with previous reports, 20 and 35% of the newly synthesized CFTR were converted to maturely glycosylated CFTR in COS-7 and HeLa cells, respectively. In contrast, CFTR maturation was virtually 100% efficient in Calu-3 and T84 cells. Furthermore, inhibition of the proteasome had no effect on CFTR biogenesis in Calu-3 cells, whereas it stabilized the immature form of CFTR in HeLa cells. Quantitative reverse transcriptase-PCR indicated that CFTR message levels are ϳ4-fold lower in Calu-3 than HeLa cells, yet steady-state protein levels are comparable. Our results question the structural instability model of wild type CFTR and indicate that epithelial cells endogenously expressing CFTR efficiently process this protein to post-Golgi compartments.