Halotolerant bacteria belonging to operational group <i>Bacillus amyloliquefaciens</i>
 in biocontrol of the rice brown stripe pathogen <i>Acidovorax oryzae</i>

Masum, Md. Mahidul Islam; Liu, Lin Lin; Yang, Min; Hossain, Md. Motaher; Siddiqa, Mst. Mahfuja; Supty, M.E.; Ogunyemi, Solabomi Olaitan; Hossain, Awlad; An, Qing; Li, Biao

doi:10.1111/jam.14088

Cited by 37 publications

(30 citation statements)

References 84 publications

(173 reference statements)

Supporting

Mentioning

Contrasting

Order By: Relevance

“…The inhibitions of bacterial biofilm formation by AgNPs were performed using the 96-well microtitre plate method as described Masum et al (2018) with slight modification. Briefly, the overnight cell suspension of Ao strain RS-2 was re-cultured into a fresh LB broth at shaker to obtain the mid-exponential growth.…”

Section: Methodsmentioning

confidence: 99%

Biogenic Synthesis of Silver Nanoparticles Using Phyllanthus emblica Fruit Extract and Its Inhibitory Action Against the Pathogen Acidovorax oryzae Strain RS-2 of Rice Bacterial Brown Stripe

et al. 2019

View full text Add to dashboard Cite

Biogenic synthesis of silver nanoparticles (AgNPs) using plants has become a promising substitute to the conventional chemical synthesis method. In this study, we report low-cost, green synthesis of AgNPs using fresh fruit extract of Phyllanthus emblica . The biosynthesized AgNPs was confirmed and characterized by analysis of spectroscopy profile of the UV-visible and Energy dispersive spectrophotometer, Fourier transform infrared, X-ray diffraction pattern, and electron microscopy images examination. UV-visible spectra showed a surface resonance peak of 430 nm corresponding to the formation of AgNPs, and FTIR spectra confirmed the involvement of biological molecules in AgNPs synthesis. In spherical AgNPs, the particle size ranged from 19.8 to 92.8 nm and the average diameter was 39 nm. Synthesized nanoparticles at 20 μg/ml showed remarkable antimicrobial activity in vitro against the pathogen Acidovorax oryzae strain RS-2 of rice bacterial brown stripe, while 62.41% reduction in OD 600 value was observed compared to the control. Moreover, the inhibitory efficiency of AgNPs increased with the increase of incubation time. Furthermore, AgNPs not only disturbed biofilm formation and swarming ability but also increased the secretion of effector Hcp in strain RS-2, resulting from damage to the cell membrane, which was substantiated by TEM images and live/dead cell staining result. Overall, this study suggested that AgNPs can be an attractive and eco-friendly candidate to control rice bacterial disease.

show abstract

Section: Methodsmentioning

confidence: 99%

Biogenic Synthesis of Silver Nanoparticles Using Phyllanthus emblica Fruit Extract and Its Inhibitory Action Against the Pathogen Acidovorax oryzae Strain RS-2 of Rice Bacterial Brown Stripe

et al. 2019

View full text Add to dashboard Cite

show abstract

“…oryzae and X. oryzae pv. oryzicola [28], Erwinia amylovora [18], Botrytis cinerea [29], Acidovorax oryzae [30], Rhizoctonia solani [31], Ralstonia solanacearum [27], and Fusarium graminearum [32]. Bacillus-based products are now commercially available, for example, RhizoVital ® (B. amyloliquefaciens FZB42; ABiTEP, GmbH, Berlin, Germany), Amylo-X ® WG (B. amyloliquefaciens subsp.…”

Section: Introductionmentioning

confidence: 99%

Endophyte Bacillus velezensis Isolated from Citrus spp. Controls Streptomycin-Resistant Xanthomonas citri subsp. citri That Causes Citrus Bacterial Canker

2019

View full text Add to dashboard Cite

Citrus bacterial canker (CBC), caused by the plant pathogenic bacterium Xanthomonas citri subsp. citri (Xcc), is a devastating disease in many commercial citrus cultivars. Every year, CBC causes a substantial reduction in fruit quality and quantity that corresponds to significant economic losses worldwide. Endophytic microorganisms produce numerous bioactive secondary metabolites that can control plant pathogens. We investigated the antagonistic activities of 66 endophytic bacteria isolated from nine citrus cultivars to control streptomycin-resistant Xcc. The suspension of Endophytic Bacteria-39 (EB-39), identified as Bacillus velezensis, exhibited the highest antibacterial activity against three wild-type and six streptomycin-resistant Xcc strains, with the inhibition zones between 39.47 ± 1.6 and 45.31 ± 1.6 mm. The ethyl acetate extract of EB-39 also controlled both wild-type and streptomycin-resistant Xcc strains, with the inhibition zones between 29.28 ± 0.6 and 33.88 ± 1.3 mm. Scanning electron microscopy indicated the ethyl acetate extract of EB-39-induced membrane damage and lysis. The experiments using the detached leaves of a susceptible Citrus species showed that EB-39 significantly reduced the incidence of canker on the infected leaves by 38%. These results strongly suggest that our newly isolated EB-39 is a novel biocontrol agent against CBC caused by wild-type and streptomycin-resistant Xcc strains.

show abstract

“…Bacterial DNA was isolated using a genomic bacterial DNA isolation Kit (Sangon Biotech (Shanghai) Co, Ltd., Shanghai, China) following the instructions in the protocol. The 16S rRNA gene was amplified by the bacterial-specific primer pairs 27F (AGAGTTTGATCGCTGCTCAG) and 1492F (GGTTACCTTGTTACGACTT) [ 17 , 18 ]. Complete volumes of PCR amplification in 50 μL were performed using the Bioer XP Thermal Cycler (Hangzhou Bioer Tech.…”

Section: Methodsmentioning

confidence: 99%

Biosynthesis of Silver Nanoparticles Using Onion Endophytic Bacterium and Its Antifungal Activity against Rice Pathogen Magnaporthe oryzae

Ibrahim

Luo²,

et al. 2020

JoF

Self Cite

View full text Add to dashboard Cite

Biosynthesis of silver nanoparticles (AgNPs) using endophytic bacteria is a safe alternative to the traditional chemical method. The purpose of this research is to biosynthesize AgNPs using endophytic bacterium Bacillus endophyticus strain H3 isolated from onion. The biosynthesized AgNPs with sizes from 4.17 to 26.9 nm were confirmed and characterized by various physicochemical techniques such as Fourier transform infrared spectroscopy (FT-IR), X-ray diffraction (XRD), UV-visible spectroscopy, transmission electron microscopy (TEM) and scanning electron microscopy (SEM) in addition to an energy dispersive spectrum (EDS) profile. The biosynthesized AgNPs at a concentration of 40 μg/mL had a strong antifungal activity against rice blast pathogen Magnaporthe oryzae with an inhibition rate of 88% in mycelial diameter. Moreover, the biosynthesized AgNPs significantly inhibited spore germination and appressorium formation of M. oryzae. Additionally, microscopic observation showed that mycelia morphology was swollen and abnormal when dealing with AgNPs. Overall, the current study revealed that AgNPs could protect rice plants against fungal infections.

show abstract

Halotolerant bacteria belonging to operational group Bacillus amyloliquefaciens in biocontrol of the rice brown stripe pathogen Acidovorax oryzae

Abstract: To our knowledge, this is the first report on biological control of halotolerant bacteria against bacterial brown stripe of rice.

Cited by 37 publications

References 84 publications

Biogenic Synthesis of Silver Nanoparticles Using Phyllanthus emblica Fruit Extract and Its Inhibitory Action Against the Pathogen Acidovorax oryzae Strain RS-2 of Rice Bacterial Brown Stripe

Biogenic Synthesis of Silver Nanoparticles Using Phyllanthus emblica Fruit Extract and Its Inhibitory Action Against the Pathogen Acidovorax oryzae Strain RS-2 of Rice Bacterial Brown Stripe

Endophyte Bacillus velezensis Isolated from Citrus spp. Controls Streptomycin-Resistant Xanthomonas citri subsp. citri That Causes Citrus Bacterial Canker

Biosynthesis of Silver Nanoparticles Using Onion Endophytic Bacterium and Its Antifungal Activity against Rice Pathogen Magnaporthe oryzae

Contact Info

Product

Resources

About