hASH1 expression is closely correlated with endocrine phenotype and differentiation extent in pulmonary neuroendocrine tumors

Abstract

The human homolog 1 of the Drosophila neurogenic achaete-scute genes, hASH1, is specifically expressed in fetal pulmonary neuroendocrine cells and in some neuroendocrine tumor cell lines. However, no data have been gathered regarding its in vivo expression in tumors. hASH1 mRNA expression was investigated by in situ hybridization in 238 surgically resected lung carcinomas, and the correlations between hASH1 expression status and immunostaining results of neuroendocrine markers chromogranin A, neural cell adhesion molecule, gastrin-releasing peptide and calcitonin, and clinical outcome were analyzed. hASH1 expression was detected in 2/20 (10%) adenocarcinomas, 4/30 (13.3%) typical carcinoids, 11/13 (84.6%) atypical carcinoids, 38/67 (56.7%) large-cell neuroendocrine carcinomas and 56/78 (71.8%) small-cell carcinomas, respectively, but not in any squamous cell carcinoma (0/21) or large-cell carcinoma (0/9). The 2 hASH1 þ adenocarcinomas also expressed multiple neuroendocrine markers. Thus, hASH1 expression was restricted to lung cancers with neuroendocrine phenotypes. However, not all neuroendocrine tumors expressed hASH1. Within the entities of large-cell neuroendocrine carcinoma and small-cell carcinoma, hASH1 expression correlated very closely with chromogranin A, gastrin-releasing peptide and calcitonin expression (Po0.0001, r ¼ 0.852), but was not related to neural cell adhesion molecule expression (P ¼ 0.8892), suggesting that hASH1 expression, at least in lung cancer, is associated with endocrine phenotype expression other than 'neuroendocrine differentiation' in a broad sense. The fact that hASH1 was virtually absent in almost fully differentiated typical carcinoids, but was expressed in most, if not all, less differentiated atypical carcinoids as well as large-cell neuroendocrine carcinomas and small-cell carcinomas, suggests that hASH1 expression in lung cancer imitates its early and transient expression in fetal development, and that hASH1 is instrumental in the establishment, but not in the maintenance, of a cellular endocrine phenotype. Finally, hASH1 expression correlated with a significantly shortened survival in small-cell carcinoma patients (P ¼ 0.041).

Differential expression of neural‐cadherin in pulmonary epithelial tumours

“…N-cadherin could be used to help rule out ADC and SCC, as few of these tumours were immunoreactive, similar to chromogranin, CD56 and polysialylated neural cell adhesion molecule, and appears to be more specific than synaptophysin, neuron-specific enolase or microtubule-associated protein-2 for neuroendocrine lesions. [25][26][27][28][29] Our data are similar to those of prior investigations, which described a minority of pulmonary ADC and SCC with N-cadherin expression. Reports of N-cadherin reactivity in pulmonary ADC have ranged from 0 to 45%.…”

Neuroendocrine differentiation in the 12T‐10 transgenic prostate mouse model mimics endocrine differentiation of pancreatic beta cells

“…However, once NE cancer appears, the cells routinely express mash-1. Similarly, hASH-1 has been reported to be highly expressed in human medullary thyroid cancer and small cell lung cancer, neuroendocrine cancer [31][32][33].…”

Differences of molecular expression mechanisms among neural cell adhesion molecule 1, synaptophysin, and chromogranin A in lung cancer cells

“…Furthermore, since most carcinoid tumors (low grade LNETs) do not express ASCL1, it is considered that REST expression is severely repressed in carcinoid tumors. 26 The proximal region of the SYPT promoter possessed modest promoter activity (middle panel of Fig. 2a).…”

“…13 LNETs also express neuronal/ neuroendocrine phenotype-specific bHLH transcription factors, and ASCL1 is used as a diagnostic marker for highgrade malignant LNETs. 9,25,26 Many neuronal genes, such as those for ion channels, neurotransmitter receptors, and neuron-specific cytoskeletons, possess a 21-base pair DNA motif (consensus sequence: TTCAGCACCACGGACAGCGCC), repressor element 1 (RE1, also called neuron-restrictive silencer element (NRSE)). [27][28][29][30][31] RE1 is a target sequence for RE1silencing transcription factor (REST, also known as neuronrestrictive silencing factor (NRSF)), and REST silences or represses its target genes in cooperation with co-repressor of REST, Sin3A/B, and histone deacetylase.…”