Heme oxygenase‑1 exerts pro‑apoptotic effects on hepatic stellate cells in�vitro through regulation of nuclear factor‑κB

Abstract

Heme oxygenase-1 (HO-1) is an antioxidant and cytoprotective protein, which has been proven to alleviate the proliferation of hepatic stellate cells (HSCs) and the development of liver fibrosis. However, the role of HO-1 in HSC apoptosis remains unclear. The aim of the present study was to investigate the effect of HO-1 on HSC apoptosis and its possible underlying mechanisms. HSCs-T6 were incubated with different concentrations of hemin (HO-1 chemical inducer) and Znpp-IX (HO-1 chemical inhibitor) for 12, 24 and 48 h. Cell viability was determined using an MTT assay. HSCs were classified into 4 groups as follows: Control, hemin, Znpp-IX and hemin+Znpp-IX co-treatment groups. Apoptosis was quantitatively measured by Annexin V/propidium iodide double staining and a terminal deoxynucleotidyl transferase dUTP nick-end labeling assay. The mRNA and protein expression of HO-1, α-smooth muscle actin, B-cell lymphoma (Bcl)-2, caspase-3 and nuclear factor (NF)-κB p65 were measured using quantitative polymerase chain reaction and western blotting. The levels of tumor growth factor (TGF)-β and interleukin (IL)-6 in HSC supernatants were examined by ELISA. The results demonstrated that HO-1 exerted antiproliferative effects on HSCs in a time- and concentration-dependent manner. Increasing HO-1 expression induced HSC apoptosis in vitro as demonstrated by a significant decrease in Bcl-2 and an increase in caspase-3 expression. Additionally, the expression of NF-κB p65 and its downstream inflammatory factors TGF-β and IL-6 in the HO-1 overexpression group was significantly decreased compared with the control group. Therefore, the present study provided evidence that HO-1 serves an anti-fibrosis role in the liver by enhancing HSC apoptosis, which was partially associated with the regulation of NF-κB and its downstream effectors.

Decursin ameliorates carbon-tetrachloride-induced liver fibrosis by facilitating ferroptosis of hepatic stellate cells

“…ECM production will be broke once intracellular energy is restrained. Inducing HSCs apoptosis, senescence, and autophagy are effective mean to repress HSCs viability and activation (Huang et al 2018;Yang et al 2018;Zhang et al 2016). Recently, ferroptosis is identified as an iron-regulated and caspase-independent cell death pathway characterized by lipid peroxidation (Latunde-Dada 2017).…”

Mevastatin-Induced AP-1-Dependent HO-1 Expression Suppresses Vascular Cell Adhesion Molecule-1 Expression and Monocyte Adhesion on Human Pulmonary Alveolar Epithelial Cells Challenged with TNF-α

“…Therefore, development of therapeutic compounds protecting against NF-κB p65-induced inflammatory responses might be a strategy for treating pulmonary diseases. Recent studies indicate that overexpression of heme oxygenase (HO)-1 inhibits the activation of NF-κB p65 to reduce liver fibrosis, intestinal barrier, pulmonary inflammation, and apoptosis [4][5][6].…”

The Role of Mesenchymal Stem Cell Secretome in the Inflammatory Mediators and the Survival Rate of Rat Model of Sepsis

“…RNA was isolated using ready-to-use kit according to the instructions of the manufacturer. For the experiment, we used the following primers: NF-κB p65 forward 5′-AACACTGCCGAGCTCAAGAT-3′ and reverse 5′-CATCGGCTTGAGAAAAGGAG-3′ primer; NF-κB p50 forward 5′-AGAGCAACCGAAACAGAGAGG-3′ and reverse 5′-TTTGCAGGCCCCACATAGTT-3′ primer; β-actin forward 5′-GTCAGGTCATCACTATCGGCAAT-3′ and reverse AGAGGTCTTTACGGATGTCAACGT primer [ 39 , 40 ].…”