Hepatic microvascular dysfunction and increased advanced glycation end products are components of non-alcoholic fatty liver disease

Abstract

BackgroundThis study aimed to investigate the pathophysiology of hepatic microcirculatory dysfunction in non-alcoholic fatty liver disease (NAFLD).MethodsIn Wistar rats, NAFLD model was induced by 20 weeks of high-fat diet (HFD) feeding. Rolling and adhesion of leukocytes and tissue perfusion in hepatic microcirculation were examined using in vivo microscopic and laser speckle contrast imaging (LSCI), respectively. Oxidative stress and inflamatory parameters were analysed by TBARs, catalase enzyme activity, RT-PCR and ELISA. The participation of advanced glycation end-products (AGE) and its receptor RAGE was evaluated by the measurement of gene and protein expression of RAGE by RT-PCR and Western-blot, respectively and by liver and serum quantification of fluorescent AGEs.ResultsWistar rats fed high-fat diet (HFD) showed increase in epididymal and abdominal fat content, systolic arterial blood pressure, fasting blood glucose levels, hepatic triglycerides and cholesterol, and impairment of glucose and insulin metabolisms. Liver histology confirmed the presence of steatosis and ultrasound analysis revealed increased liver size and parenchymal echogenicity in HFD-fed rats. HFD causes significant increases in leukocyte rolling and adhesion on hepatic microcirculation and decrease in liver microvascular blood flow. Liver tissue presented increase in oxidative stress and inflammtion. At 20 weeks, there was a significantly increase in AGE content in the liver and serum of HFD-fed rats and an increase in RAGE gene expression in the liver.ConclusionThe increase in liver AGE levels and microcirculatory disturbances could play a role in the pathogenesis of liver injury and are key components of NAFLD.

The effect of varied exercise intensity on antioxidant function, and aortic endothelial cell function and serum lipids in a non-alcoholic fatty liver disease rats

“…noted that regular moderate training in humans appears beneficial for oxidative stress and health, conversely, acute exercise leads to increased oxidative stress (22), presumably as their a period of adaptation that is missing from acute exercise training. Pereira et al also showed high-intensity exercise may induce oxidative stress (23). Li et al .…”

Effects of hydrogen sulphide on oxidative stress, inflammatory cytokines, and vascular remodelling in l‐NAME‐induced hypertension

“…The primer sequences of glyceraldehyde 3‐phosphate dehydrogenase (GAPDH), IFN‐γ, and VCAM‐1 were synthesized by Metabion International. Primer sequences are: GAPDH forward 5′‐CCATTCTTCCACCTTTGATGCT‐3′, reverse 5′‐TGTTGCTGTAGCCATATTCATTGT‐3′; IFN‐γ forward 5′‐AACCAGGCCATCAGCAACAACA‐3′, reverse 5′‐ACCGACTCCTTTTCCGCTTCCT‐3′ and VCAM‐1 forward 5′‐GCGAAGGAAACTGGAGAAGACA‐3′, reverse 5′‐ACACATTAGGGACCGTGCAGTT‐3′ …”

Dietary Synbiotic Supplementation Protects Barrier Integrity of Hepatocytes and Liver Sinusoidal Endothelium in a Mouse Model of Chronic-Binge Ethanol Exposure

“…Advanced glycation end-products (AGE) accumulate in metabolic disorders, such as hepatic steatosis, which is the initiating condition in ALD. Plasma AGEs increase markedly in patients with end-stage liver disease, indicating the important role of the liver in catabolizing AGEs [31]. Uptake of AGE in liver endothelial, Kupffer, and parenchymal cells accounted for roughly 60%, 25%, and 10%-15%, respectively, of hepatic elimination [31].…”

“…Plasma AGEs increase markedly in patients with end-stage liver disease, indicating the important role of the liver in catabolizing AGEs [31]. Uptake of AGE in liver endothelial, Kupffer, and parenchymal cells accounted for roughly 60%, 25%, and 10%-15%, respectively, of hepatic elimination [31]. Since we previously reported that synbiotic supplementation protected against hepatic steatosis and markers of oxidative stress [14], we analyzed liver sections in mice for the protein expression of receptors for AGE (RAGE) and galectin-3 by immunostaining and immunoblotting.…”

“…Most complications leading to morbidity in metabolic syndrome are of vascular origin, therefore it is of interest that non-alcoholic fatty liver disease is associated with hepatic microvascular dysfunction and increased AGE [31]. Since Kupffer cells and LSEC are major cellular sites of AGE uptake and clearance, AGE/AA-AGE accumulation in the liver could be associated with hepatic microvascular damage and ALD.…”