Hepatitis C virus genotypes in France: comparison of clinical features of patients infected with HCV type I and type II

Qu, Di; Li, Jisu; Vitvitski, L.; Mechai, S.; Berby, Françoise; Tong, Shuping; Bailly, François; Wang, Qing-Shen; Martin, Jean−Louis; Trépo, C.

doi:10.1016/s0168-8278(94)80139-8

Cited by 63 publications

(26 citation statements)

References 21 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…It remains to be seen whether or not such clinically important features of genotype II/lb are shared by other genotypes in genetic group 1. Some groups of investigators report differences in the response to interferon between patients infected with HCV genotype I/la and those infected with II/lb (Qu et al, 1994;Nousbaum et al, 1995), while others do not (Mahaney et al, 1994). Additional clinical and therapeutic trials are required to settle this.…”

Section: Discussionmentioning

confidence: 99%

Hepatitis C virus variants from Jakarta, Indonesia classifiable into novel genotypes in the second (2e and 2f), tenth (10a) and eleventh (11a) genetic groups

Tokita

Okamoto

Iizuka

et al. 1996

Journal of General Virology

142

View full text Add to dashboard Cite

Hepatitis C virus (HCV) isolates from 126 hepatitis patients in Jakarta, Indonesia were genotyped by PCR with genotype-specific primers deduced from the HCV core gene. Fifty-five isolates (44%) were classified as genotype II/lb, 15 (12 %) as lc, 33 (26 %) as III/2a, and 1 (1%) as V/3a, while the remaining 22 (17 %) were not classifiable into any of the five common genotypes (I/la, II/lb, III/2a, IV/2b and V/3a) or lc. Sequences of a part of the NSSb region [1093 bp (nucleotides 8279-9371)] of the 22 isolates of unclassifiable genotype were subjected to pair-wise comparison and phylogenetic analysis along with those of 62 isolates of 25 genotypes in nine genetic groups. Seven of the isolates were classified into 2e and two into 2f, representing novel genotypes in genetic group 2, while ten and three were classified into two new genetic groups, l0 and 11, respectively, and their genotypes were provisionally designated 10a and l la. The isolates of genotype 10a (JK049) and 1 la (JK046) were sequenced in full. Comparison of 24 HCV genomes including those of JK049 and JK046, over the entire genome and subgenomic regions, supported the classification of HCV into 11 genetic groups.

show abstract

Section: Discussionmentioning

confidence: 99%

Hepatitis C virus variants from Jakarta, Indonesia classifiable into novel genotypes in the second (2e and 2f), tenth (10a) and eleventh (11a) genetic groups

Tokita

Okamoto

Iizuka

et al. 1996

Journal of General Virology

142

View full text Add to dashboard Cite

show abstract

“…All patients completed therapy and were then divided into viral load are two main independent predictive factors. [3][4][5][6][7][8][9][10][11][12][13][14][15] three groups according to the kinetics of their serum alanine transaminase (ALT) activity during and after IFN-a therapy. The longterm responders (20 patients) were defined as those whose ALT activity became normal during the therapy and remained within the SSCP was performed on serum samples obtained just before start-of primers used to amplify HCV genotype 3a were as follows: outer sense primer 5 GCCATCTTTCAGGACATCGAATGGC 3 (nucleoing the treatment, stored at 030ЊC without thawing (maximal length of storage: 3 years), and identified in our serum bank using the tides 1271-1295) outer anti-sense primer 5 TTCAACTCTACTGGA-TGTCCTCA 3 (nucleotides 1678 to 1700), inner sense primer 5 Polytheq software program (Data-Info, Paris, France).…”

Section: 2526mentioning

confidence: 99%

mentioning

confidence: 99%

Hepatitis C virus genome complexity correlates with response to interferon therapy: A study in French patients with chronic hepatitis C

et al. 1997

View full text Add to dashboard Cite

However, it is clear that these two variables are insufficient Recent studies performed in Japan have suggested to distinguish long-term from nonresponders or transient rethat hepatitis C virus (HCV) genome heterogeneity sponders precisely. To make this distinction, several studies might be taken as a predictive virological parameter of from Japan, based on single-strand conformation polymorresponse to interferon alfa (IFN-a) treatment. However, phism (SSCP) and/or sequencing procedures, have suggested there is presently no information on the impact of this that the degree of HCV genome complexity might influence virological parameter in patients from Western counthe efficacy of IFN-a therapy. [16][17][18][19][20][21] HCV is an RNA virus that tries infected by different HCV genotypes. We have inshows marked genetic variability, especially in some domains vestigated this issue by using amplification of HCV E2 of the envelope protein. [22][23][24] This high rate of mutation achypervariable region 1, followed by single-strand conforcounts for the circulation in a given infected patient of a popumation polymorphism assay (PCR-SSCP). We have studlation of HCV RNA molecules, referred to as quasispecies, and ied 95 French patients infected with various genotypes this heterogeneity can be rapidly evaluated by polymerase and treated with IFN-a-2b. We analyzed the impact of chain reaction (PCR) followed by SSCP or heteroduplex gelthe following parameters by univariate and multivariate shift analysis. 22,25,26 analyses: HCV heterogeneity, HCV genotype, viral load, However, none of these studies has analyzed whether the and liver histology in response to therapy. Age ú40 years complexity of the HCV genome is really an important pre-(P õ .01), viral load ú35 1 10 5 Eq/mL (P õ .01), genotype dictive parameter of IFN-a response in a large series of pa-1 (P õ .01), and a number of SSCP bands ú3 (P õ .001) tients from Western countries infected by different HCV gewere significantly associated with nonresponse or renotypes. In particular, it is not presently known whether this lapse; cirrhosis was associated with nonresponse. In correlation holds in subjects infected with HCV genotypes multivariate analysis, three variables were indepenother than 1b. We have therefore investigated this issue in dently associated with the absence of long-term rea series of French patients treated with IFN-a-2b for HCVsponse: SSCP bands ú3, genotype 1, and viral load ú35 related chronic active hepatitis. ; thus, most subjects will show either months (3 times per week) at a dose of 3 MU for 57 patients and for nonresponse or relapse after therapy.2 Therefore, the identifi-the remaining 38 patients at a dose of 6 MU for 6 months followed cation of prognostic factors that would allow the distinction by 3 MU for another 6 months. There was no significant difference between the groups before IFN administration according to age (44.2 between long-term responders and nonresponders or relapsers importance of virological parameters: both HCV genotype and...

show abstract

“…[8][9][10][11][12] One potentially confounding factor in the studies from Pozzato et al and Qu et al is that the mean age of the patients with genotype lb was significantly higher than the patients infected with other genotypes, thus the severity of liver disease could be related to duration of infection rather than genotype. 10,11 However, the case for a direct pathogenetic effect of virus genotype is strengthened by data suggesting that patients with genotype lb infection develop acute and/or chronic hepatitis following liver transplantation. 13 Also, infection with genotype 1b predicts a poorer response to α-interferon in studies from Japan 14,15 and France.…”

mentioning

confidence: 99%

Hepatitis C Virus Genotypes in a Cohort of Middle Eastern Patients

Watson

Al-Mardini

Awadh³

et al. 1999

Ann Saudi Med

View full text Add to dashboard Cite

Design and Methods: Serum from 81 Middle Eastern HCV ELISA-2-positive patients was analyzed for the presence of HCV RNA by PCR. RNA-positive patients were genotyped by selective hybridization of amplicons to HCV genotype-specific oligonucleotides (InnoLipa2, Innogenetics, Belgium). Where possible, data was also obtained on racial origin, liver histology, serum ALT, prothrombin time, albumin, and risk factors for infection. Results: Sixty-five of 81 patients were HCV RNA-positive. A higher proportion of Middle Eastern patients were genotype 4 compared to equivalent studies from Western Europe, USA and Japan. However, the most common genotype was la. No significant difference in genotype was found between patients with chronic hepatitis and patients with cirrhosis. Conclusions: Eight of 65 (12%) patients were genotype 4, but the most common genotype was la, a "Western" genotype (24/65, 37%). The mean age of cirrhotics was low compared to Western studies. This may be due to infection in early childhood or race-related host factors. Twelve of 65 patients (18%) were not classifiable for genotype using InnoLipa2. This may be due to multiple infecting genotypes in these patients, or unusual, non 1-3 HCV genotypes which cannot be classified by InnoLipa2.

show abstract

Hepatitis C virus genotypes in France: comparison of clinical features of patients infected with HCV type I and type II

Cited by 63 publications

References 21 publications

Hepatitis C virus variants from Jakarta, Indonesia classifiable into novel genotypes in the second (2e and 2f), tenth (10a) and eleventh (11a) genetic groups

Hepatitis C virus variants from Jakarta, Indonesia classifiable into novel genotypes in the second (2e and 2f), tenth (10a) and eleventh (11a) genetic groups

Hepatitis C virus genome complexity correlates with response to interferon therapy: A study in French patients with chronic hepatitis C

Hepatitis C Virus Genotypes in a Cohort of Middle Eastern Patients

Contact Info

Product

Resources

About