Hepatocyte growth factor activator inhibitor type-2 (HAI-2)/SPINT2 contributes to invasive growth of oral squamous cell carcinoma cells

Abstract

Hepatocyte growth factor activator inhibitor (HAI)-1/SPINT1 and HAI-2/SPINT2 are membrane-anchored protease inhibitors having homologous Kunitz-type inhibitor domains. They regulate membrane-anchored serine proteases, such as matriptase and prostasin. Whereas HAI-1 suppresses the neoplastic progression of keratinocytes to invasive squamous cell carcinoma (SCC) through matriptase inhibition, the role of HAI-2 in keratinocytes is poorly understood. In vitro homozygous knockout of the SPINT2 gene suppressed the proliferation of two oral SCC (OSCC) lines (SAS and HSC3) but not the growth of a non-tumorigenic keratinocyte line (HaCaT). Reversion of HAI-2 abrogated the growth suppression. Matrigel invasion of both OSCC lines was also suppressed by the loss of HAI-2. The levels of prostasin protein were markedly increased in HAI-2-deficient cells, and knockdown of prostasin alleviated the HAI-2 loss-induced suppression of OSCC cell invasion. Therefore, HAI-2 has a pro-invasive role in OSCC cells through suppression of prostasin. In surgically resected OSCC tissues, HAI-2 immunoreactivity increased along with neoplastic progression, showing intense immunoreactivities in invasive OSCC cells. In summary, HAI-2 is required for invasive growth of OSCC cells and may contribute to OSCC progression.

Aberrant methylation and silencing of the SPINT2 gene in high‐grade gliomas

“…Reverse transcription‐PCR was carried out as described elsewhere using the following primers: SPINT2 , forward 5′‐CGGGGCAATAAGAACAGCT‐3′ and reverse 5′‐AGCTGCTCCTTGTCATCATCTCC‐3′; and β‐actin ( ACTB ), forward 5′‐ ATTGCCGACAGGATGCAGA ‐3′ and reverse 5′‐ GAGTACTTGCGCTCAGGAGGA ‐3′. Primer sequences for HGFA ( HGFAC ), matriptase ( ST14 ), hepsin ( HPN ), TMPRSS2 , TMPRSS13 , human airway trypsin‐like protease (HAT: TMPRSS11D ), HGF , MET , HAI‐1 ( SPINT1 ), and GAPDH are described in Table .…”

“…For immunoblotting, cultured cells (approximately 70% confluency) were washed 3 times with PBS and the cellular proteins were extracted with 1% (v/v) Triton X‐100 in PBS with protease inhibitor cocktail (Merck & Co., Kenilworth, NJ, USA). For immunoblotting, each extracted protein was separated by SDS‐PAGE under nonreducing conditions, transferred onto an Immobilon membrane (Millipore, Bedford, MA, USA), and processed for HAI‐2/SPINT2 detection using mouse mAb 2A6121 as described elsewhere . For the detection of MET and phosphorylated MET, cells were extracted in the presence of 100 mmol/L NaF and 1 mmol/L Na 3 VO 4 and SDS‐PAGE was carried out under reducing conditions.…”

“…4,9 Therefore, HAI-1/SPINT1 and HAI-2/SPINT2 have generally been implicated as suppressors of cancer progression by inhibiting HGF-MET signal transduction, 4 although contradicting results have also been reported for HAI-2/SPINT2. [10][11][12] Previously, we reported that SPINT2 mRNA levels were significantly reduced along with the progression of gliomas and HAI-2/ SPINT2 protein suppressed Matrigel invasion of glioblastoma cell lines. 13 Subsequently, it was reported that the hypermethylation of the SPINT2 promoter region underpins reduced HAI-2/SPINT2 expression in the U87 human glioblastoma cell line.…”

“…The extracellular activation of proHGF is critical for the biological activity of HGF through its specific receptor tyrosine kinase (MET); MET‐induced signals are involved in invasive growth and drug resistance of various types of cancers . Therefore, HAI‐1/SPINT1 and HAI‐2/SPINT2 have generally been implicated as suppressors of cancer progression by inhibiting HGF‐MET signal transduction, although contradicting results have also been reported for HAI‐2/SPINT2 …”

Dysregulation of Type II Transmembrane Serine Proteases and Ligand-Dependent Activation of MET in Urological Cancers

“…(including matriptase), which induces HGF/MET signaling axis, has been considered a major suppressive function in cancer progression [11,12]. Additionally, an alternative function such as the activation of caspase 3 in esophageal squamous cell carcinoma leading to the promotion of apoptosis and inhibition of proliferation was also reported [48,51]. However, HAI-2 has also been reported to be required for invasive growth in oral squamous cell carcinoma, which suggests that the role of HAI-2 may be tissue or cell-type specific and dependent on targeting TTSPs [52].…”