Hepatocyte growth factor induces hypoxia‐related interleukin‐8 expression in lung adenocarcinoma cells

Abstract

Rapid growth of cancer cells often creates insufficient supply of oxygen and nutrients in the tumour nest. The frequent detection of hypoxia-inducible factor (HIF) and interleukin-8 (IL-8) in afflicted tissues suggests that IL-8 expression could be associated with elevated levels of HIF. Recently, we found that hypoxia also upregulated the expression of hepatocyte growth factor (HGF) in lung adenocarcinoma (LAD) cells. However, the relationship between HGF and IL-8 has not been investigated in LAD cells. In this study, we found that HGF induced IL-8 expression in LAD. Interestingly, hypoxia also increased the level of prostaglandin F(2alpha) (PGF(2alpha)), a product of dihydrodiol dehydrogenase (DDH). When expression of DDH was suppressed by siRNA, the levels of PGF(2alpha), HGF and IL-8 were reduced; however, their levels returned to normal after DDH was reintroduced. These data suggest that hypoxia induces biosynthesis of PGF(2alpha), which then activates HGF and IL-8 expression. The results provide a reasonable explanation of how PGF(2alpha), HGF and IL-8 exert their effects on cancer cell metastasis.

Human papillomavirus infection and expression of ATPase family AAA domain containing 3A, a novel anti-autophagy factor, in uterine cervical cancer

“…However, using in situ hybridization could adequately locate the HPV infection in UCC, not in the neighboring tissues (6). Moreover, our results indicate that HPV infection correlated with ATAD3A levels as well as those of c-MET, IL-8 and Ki-67 as well as with FIGO stages, lymph node involvement and patients' survival, which corresponded well with our prior studies that expression of these genes might be orchestrated with one another to form a malicious cycle in favor of cancer progression (6,26,27). It is worth noting that, Chinese UCC patients had a higher tendency of overexpressing ATAD3A than the American patients.…”

Hepatocyte growth factor and HER2/neu downregulate expression of apoptosis-inducing factor in non-small cell lung cancer

“…5B). The results are consistent with our in vitro data that nicotine reduced AIF expression (26,33).…”

“…Recently, by confocal immunofluorescence microscopy we found that HGF, which was frequently detected in smoker patients, was expressed on surface of cancer cells (33). Therefore, the overexpressed HGF could only interact with nearby cells.…”

Hydrogen sulfide inhibits IL-8 expression in human keratinocytes via MAP kinase signaling

“…[29][30][31] ELISA IL-8 release in cell culture media was quantified by human IL-8/NAP-1 enzyme-linked immunosorbent assay (Bender Medsystems Vienna, Austria). [32][33][34] Spent medium from NCTC cell cultures was incubated in 96-well plates coated with anti-human IL-8. After washing of unbound IL-8, wells were incubated with biotin-conjugated anti-IL-8/NAP-1 antibody.…”

“…Total RNA (1 mg) was reverse transcribed and progressive dilutions (1/ 10, 1/100, 1/1000) were then subjected to PCR amplification. cDNA of IL-8 was amplified using the primers previously described by Chiang 34 and by a new set of primers developed by us that were more efficient. Thus, primers used were AGCCAGGAAGAAACCACCGGA and TCCACAACCCTCTG CACCCAGT that generated an expected PCR product of 315 bp (NM000584 Genbank locus, GI:28610153).…”