Hepatocyte growth factor reduces CXCL10 expression in keratinocytes

Abstract

Keratinocytes secrete vascular endothelial growth factor (VEGF) and angioregulatory chemokines during cutaneous wound healing. Hepatocyte growth factor (HGF) promotes skin re-epithelialization by increasing VEGF expression in keratinocytes. Here, we investigated the regulatory roles of HGF in the expression of genes encoding angiogenic and angiostatic chemokines in keratinocytes and found that HGF specifically inhibits mRNA expression of the angiostatic chemokine CXCL10 in both mouse primary keratinocytes and in the human keratinocyte cell line HaCaT through the MEK/ERK cascade. Furthermore, HGF inhibited tumor necrosis factor-α-induced CXCL10 expression at both mRNA and protein levels in HaCaT cells. Thus, HGF may orchestrate angiogenesis in wounded skin by modulating both VEGF and CXCL10 expression in keratinocytes.

Ultraviolet B irradiation decreases CXCL10 expression in keratinocytes through endoplasmic reticulum stress

“…Mouse Grp78 CTGCTGAGGCGTATTTGGGA and TCGCTGGGCATCATTGAAGT; mouse CHOP AATAACAGCCGGAACCTGAGG and CTCATACCAGGCTTCCAGCTC. Sequences of primers for human CXCL10 , mouse Cxcl10 , human HPRT , mouse Hprt were described previously 16 …”

“…Sequences of primers for human CXCL10, mouse Cxcl10, human HPRT, mouse Hprt were described previously. 16 2.6 | Preparation of cell lysates, nuclear extracts, and plasma membrane fractions Cells were lysed in PLC buffer (50 mM HEPES [pH 7.0], 150 mM NaCl, 10% glycerol, 1.0% Triton X-100, 1.5 mM MgCl 2 , 1 mM EGTA, 10 mM sodium pyrophosphate, 100 mM NaF, and 1 mM sodium orthovanadate) containing protease inhibitors or RIPA buffer (20 mM Tris-HCl [pH 7.5], 150 mM NaCl, 1 mM ethylenediaminetetraacetic acid (EDTA), 1 mM EGTA, 1% NP-40, 1% sodium deoxycholate, 2.5 mM sodium pyrophosphate, 1 mM β-glycerophosphate, 1 mM Na 3 VO 4, 1 μg/ml leupeptin), and centrifuged at 12,000g to collect supernatants as cell lysates. For the preparation of nuclear extracts, cells were scraped from dishes in PBS(−), pelleted washed in hypotonic buffer (10 mM HEPES buffer [pH 7.9], 1.5 mM MgCl 2 , 5 mM KCl, 1 mM phenylmethylsulfonyl fluoride [PMSF], 1 mM dithiothreitol), and lysed by resuspension in the same buffer with 0.1% Nonidet P-40.…”

“…During wound healing, chemokines, such as CXCL10, are expressed at the site of inflammation to recruit T cells and neutrophils 14,15 . The expression of CXCL10 in keratinocytes is also regulated by growth factors to orchestrate tissue regeneration 16 . The roles of CXCL10 in various infectious diseases are either defense or promotion of infection 14,15 .…”

“…14,15 The expression of CXCL10 in keratinocytes is also regulated by growth factors to orchestrate tissue regeneration. 16 The roles of CXCL10 in various infectious diseases are either defense or promotion of infection. 14,15 Elevated CXCL10 expression has been reported to precede the onset of clinical symptom during HIV infection.…”

Anti-inflammatory effect of HGF responses to oral traumatic ulcers using an HGF-Tg mouse model

“…HGF has been reported to modulate the inflammatory environment and enhance wound healing and regeneration in animal models of inflammation-associated diseases, including a skin inflammation model [ 17 ], multiple sclerosis model [ 18 ], pulmonary artery hypertension model [ 19 ] and bronchiolitis obliterans model [ 20 ] . HGF can mediate wound healing by accelerating the regeneration of epithelial cells [ 21 , 22 ] and by maintaining normal immune function [ 17 ]. Clinical data have shown that HGF gene therapy can significantly decrease the size of ulcers in patients with critical limb ischemia [ 23 , 24 ].…”