Herpes simplex virus pathogenesis in transgenic mice is altered by the homeodomain protein Hox 1.3

Mitchell, William J.; Santo, Ronald J. De; Zhang, Shang-Ding; Odenwald, Ward F.; Arnheiter, Heinz

doi:10.1128/jvi.67.8.4484-4491.1993

Cited by 15 publications

(9 citation statements)

References 23 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…Sections from the eyes that were assayed by in situ PCR were also evaluated for evidence of lesions by lightmicroscopic evaluation of hematoxylin-and eosin-stained sections. Other sections from the same eyes were deparaffinized and assayed for the presence of viral antigen by the avidin-biotin-peroxidase method (Vector) with HSV-1 antiserum (Dako) at a 1:1,000 dilution (25,26). As controls, uninfected mouse eyes were reacted with the HSV-1 antiserum and infected eyes were reacted with control rabbit serum in the same assays.…”

Section: Methodsmentioning

confidence: 99%

“…Viral culture. Sections of eyelid skin and conjunctiva which had been dissected free from other ocular tissues were homogenized, and each homogenate was assayed for HSV-1 on Vero cells overlaid with methylcellulose in a standard plaque assay (26). Culture results were expressed as the number of eyes from which virus could be cultured from combined eyelid skin and conjunctiva.…”

Section: Methodsmentioning

confidence: 99%

See 1 more Smart Citation

Persistence of Herpes Simplex Virus Type 1 DNA in Chronic Conjunctival and Eyelid Lesions of Mice

Maggs¹,

Chang

Nasisse³

et al. 1998

J. Virol.

View full text Add to dashboard Cite

Herpes simplex virus type 1 (HSV-1) causes chronic blepharitis and conjunctivitis as well as keratitis in humans. The pathogenesis of these inflammatory ocular and dermal lesions is not well understood. We have examined the persistence of HSV-1 DNA and its relationship to inflammatory lesions in the conjunctiva and eyelid skin of mice which were inoculated with HSV-1 by the corneal route. Viral DNA was detected by in situ PCR in the conjunctiva and eyelid tissue of infected mice at 5, 11, 23, and 37 days postinfection (p.i.). This DNA was localized in the epithelial cells of the conjunctiva and hair follicles and in the epidermal cells of the eyelid skin. Viral proteins were not detected in the conjunctiva or the eyelid skin after 5 days p.i., even though histopathological lesions were found at 23 and 37 days p.i. in both tissues. The DNA-containing cells were adjacent to sites of inflammation in the chronic lesions in both the conjunctiva and the eyelid skin. A similar temporal and spatial relationship between HSV-1 DNA and inflammatory lesions has been previously reported for the cornea. Our data suggest that the lesions in the cornea, conjunctiva, and eyelid skin progress similarly. Further studies are required to determine whether the long-term presence of HSV-1 is involved in the mechanism by which these chronic inflammatory lesions develop. The presence of HSV-1 DNA in these extraocular tissues for extended periods may constitute persistent viral infection of nonneuronal cells.

show abstract

Section: Methodsmentioning

confidence: 99%

Section: Methodsmentioning

confidence: 99%

Persistence of Herpes Simplex Virus Type 1 DNA in Chronic Conjunctival and Eyelid Lesions of Mice

Maggs¹,

Chang

Nasisse³

et al. 1998

J. Virol.

View full text Add to dashboard Cite

show abstract

“…The ICP4 promoter fragment was ligated (40) into the blunt-ended pNlacF plasmid (restriction digested at the SalI site and made blunt ended by treatment with Klenow enzyme) containing the Esch-erichia coli ␤-galactosidase coding sequence and including a simian virus 40 nuclear translocation signal (27). The XbaI-HindIII fragment from the final construct was isolated and purified, and approximately 200 copies were injected (17,29) into each (C57BL/6 ϫ C3H)F 1 ϫ (C57BL/6 ϫ C3H)F 1 one-cell embryo. Three founder animals (designated Tg0002, Tg6305, and Tg6307) were identified, and transgenic lines were established by brother-sister matings.…”

Section: Methodsmentioning

confidence: 99%

“…Two of the lines described in this report have been assigned designations according to the standardized rules for nomenclature in transgenic mice: line Tg6305, TgN(HS VieRp)1wm; line Tg6307, TgN(HSVieRp)2wm. Heterozygous transgenic mice and their nontransgenic control littermates were used in this study; these mice were identified by PCR using tail DNA (29,30,32) and primers (GCATCGAG CTGGGTAATAAGCGTTGGCAAT and GACACCAGACCAACTGGTAAT GGTAGCGAC) for the ␤-galactosidase coding sequence.…”

Section: Methodsmentioning

confidence: 99%

“…In situ hybridization studies have shown that the levels of certain transcription factors (such as Oct 1) which interact with IE promoters vary in different neurons (16). In transgenic mice, it has been shown that a mouse homeodomain protein, Hoxa-5 (Hox 1.3), which binds the se-quence TAAT within the TAATGARAT regulatory sequences of the HSV IE promoters alters the course of viral infection and disease (29). It has also been shown that infection with HSV type 1 (HSV-1) induces expression of the Oct 1 gene in sensory neurons (49).…”

mentioning

confidence: 99%

See 1 more Smart Citation

Neurons differentially control expression of a herpes simplex virus type 1 immediate-early promoter in transgenic mice

Mitchell

1995

J Virol

Self Cite

View full text Add to dashboard Cite

The immediate-early proteins of herpes simplex virus control the cascade of viral gene expression during lytic infection. It is not known which viral or host proteins control the reactivation of the viral genome in latently infected neurons. To determine whether neuronal proteins can regulate a herpes simplex virus immediate-early promoter in vivo, transgenic mice containing the promoter regulatory region of the herpes simplex virus type 1 immediate-early gene (ICP4) fused to the bacterial ␤-galactosidase gene were generated. Two lines of mice, in the absence of viral proteins, displayed ICP4 promoter activity in neurons in specific locations in the central nervous system. The anatomic locations of these neurons were the hippocampus, cerebellar cortex, superior colliculus, indusium griseum, mammillary nucleus, cerebral cortex, and the dorsal laminae of the dorsal horns of the spinal cord. Additional subsets of neurons expressed the ICP4 promoter at lower levels; these included trigeminal ganglia and retinas. In a third line of mice, lower levels of expression were present in many of the above-described neurons. Many types of neurons, nearly all nonneuronal cells in the central nervous system, and some non-nervous system tissues were negative. Viral proteins including VP16 are not necessary to induce transcription from the ICP4 promoter in many neurons and some other cell types but may be required in most cells in vivo. An approximately 100-fold-greater number of neurons in the trigeminal ganglia expressed ICP4 promoter activity in newborn mice compared with adults. These data provide direct evidence that host proteins are sufficient to activate a herpes simplex virus immediate-early promoter in neurons in vivo and that a differential expression pattern for this promoter exists within different neuronal phenotypes and between the same neurons in different ages of mice.

show abstract

Resistance to Pseudorabies Virus Infection in Transgenic Mice Expressing the Chimeric Transgene That Represses the Immediate-Early Gene Transcription

et al. 1999

View full text Add to dashboard Cite

A chimeric gene encoding a fusion protein consisting of the DNA-binding domain of the immediate-early (IE) protein of pseudorabies virus (PRV) and a tail-truncated VP16 of herpes simplex virus 1, lacking the transcription activation domain, has been shown to repress transcription of the PRV IE gene, resulting in the inhibition of PRV growth in vitro. To assess the antiviral potential of the fusion protein in vivo, transgenic mice containing the chimeric gene under the control of the virus- and interferon-inducible Mx 1 promoter were generated. A transgenic mouse line showed marked resistance to PRV infection when the mice were challenged intranasally with PRV. Inhibition of PRV replication was also observed in monolayers of embryonic cells prepared from the transgenic mice. In the cells infected with PRV, transcription of the PRV IE gene was repressed. The present results indicate that the chimeric gene is able to exert a significant antiviral effect against PRV infection in vivo.

show abstract

Herpes simplex virus pathogenesis in transgenic mice is altered by the homeodomain protein Hox 1.3

Cited by 15 publications

References 23 publications

Persistence of Herpes Simplex Virus Type 1 DNA in Chronic Conjunctival and Eyelid Lesions of Mice

Persistence of Herpes Simplex Virus Type 1 DNA in Chronic Conjunctival and Eyelid Lesions of Mice

Neurons differentially control expression of a herpes simplex virus type 1 immediate-early promoter in transgenic mice

Resistance to Pseudorabies Virus Infection in Transgenic Mice Expressing the Chimeric Transgene That Represses the Immediate-Early Gene Transcription

Contact Info

Product

Resources

About