Herpes virus-like sequences are specifically found in Kaposi sarcoma lesions.

Abstract

Aim-To detect the prevalence of herpes virus-like DNA sequences in AIDS associated Kaposi sarcoma (KSHV) lesions and normal tissue. Methods-KSHV detection was performed by polymerase chain reaction (PCR) using four different sets of primers. PCR products were cloned, sequenced, and analysed. Results-All of four biopsies of Kaposi sarcoma lesions and all of three paraffin embedded Kaposi sarcoma tissues were positive for KSHV, while normal tissue from the same patients was negative. Sequence analysis of amplification products revealed polymorphisms that result in amino acid changes ofthe predicted sequence. Conclusions-KSHV is prevalent in tissues from Kaposi sarcoma, suggesting a role in the development of the tumour. On this basis, anti-herpes virus agents should be considered to control KIAposi sarcoma. (J Clin Pathol 1996;49:306-308)

Herpesviruses in periodontal pocket and gingival tissue specimens

“…HHV‐7 primers encompassed a novel HHV‐7 viral sequence partly homologous to that of the HHV‐6 U42 gene (outer HHV‐7 primers were HHV‐7 MK1 5′‐TTTTTACATTTGGCTTGCTTTTTG‐3′ and HHV‐7 MK2 5′A T A T T T C T G T A C C T A T C T T C C C C AA‐3′; inner HHV‐7 primers were HHV‐7 MK3 5′‐TGCTTTTTGGTTTGTAAATTC‐3′ and HHV‐7 MK4 5′G A A T T T A T G G A G T T T G G T C T G ‐ 3′ ( 14). HHV‐8 primers flanked a sequence of the major capsid protein gene (outer HHV‐8 primers were KS3‐5 5′C C C T T C T A G C G T T G G C T A G T C ‐ 3′ and KS3‐3 5′‐CAGATGACGCCATACCCCCCCCGCTCT‐3′; inner HHV‐8 primers were KS2‐5 5′‐AGCCGAAAGGATTCCACCAT‐3′ and KS1‐3 5′ ‐ T C C G T G T T G T C T A C G T C C A ‐ 3′) ( 15).…”

Kaposi's Sarcoma-Associated Herpesvirus/Human Herpesvirus 8 RTA Reactivates Murine Gammaherpesvirus 68 from Latency

“…In order to define the domains of RTA responsible for their functional differences in viral promoter activation and initiation of the MHV-68 lytic cycle, chimeric RTA proteins were constructed by exchanging the N-terminal and C-terminal domains of the RTA proteins. Our data suggest that the species specificity of MHV-68 RTA resides in the N-terminal DNA binding domain.Gammaherpesviruses are distinguished by their ability to establish latency in lymphocytes and are associated with malignancies, such as various B-cell lymphomas (1-3, 31, 33) and Kaposi's sarcoma (5,20,22,24). Murine gammaherpesvirus 68 (MHV-68) is classified as a type 2 gammaherpesvirus and is currently used as a mouse model for human gammaherpesviruses Kaposi's sarcoma-associated herpesvirus/human herpesvirus-8 (HHV-8) and Epstein-Barr virus (EBV) (11,21,27,29).…”

Lack of evidence of human herpesvirus 8 DNA sequences in HIV-negative patients with systemic plasmacytosis

“…Primers ks4–3 and ks4–5 were used in a nested PCR. 8 In this analysis, 10 mL of the PCR products obtained with primers KS1 and KS2 were added to the PCR mixtures containing primers ks4–3 and ks4–5 and amplified as described above. The PCR products were electrophoresed through 2% agarose gel and then stained with ethidium bromide.…”