Heterodimerization of Mdm2 and Mdm4 is critical for regulating p53 activity during embryogenesis but dispensable for p53 and Mdm2 stability

Pant, Vinod; Xiong, Shunbin; Iwakuma, Tomoo; Quintás‐Cardama, Alfonso; Lozano, Guillermina

doi:10.1073/pnas.1102241108

Cited by 120 publications

(169 citation statements)

References 37 publications

Supporting

Mentioning

162

Contrasting

Order By: Relevance

“…We validated this notion by measuring the level of MDMX transcripts in MCF-7 cells treated with NRG1 at different time points (6,12, and 24 h). The result showed no statistically significant difference in MDMX mRNA levels after NRG1 treatment at any of the time points (Fig.…”

Section: Her4 Overexpression Stabilizes the Mdmx-mdm2 Complexmentioning

confidence: 99%

See 1 more Smart Citation

Human epidermal growth factor receptor 4 (Her4) Suppresses p53 Protein via Targeting the MDMX-MDM2 Protein Complex

Gerarduzzi¹,

Polo²,

Liu³

et al. 2016

Journal of Biological Chemistry

View full text Add to dashboard Cite

Edited by Eric FearonDeregulated receptor tyrosine kinase (RTK) signaling is frequently associated with tumorigenesis and therapy resistance, but its underlying mechanisms still need to be elucidated. In this study, we have shown that the RTK human epidermal growth factor receptor 4 (Her4, also known as Erbb4) can inhibit the tumor suppressor p53 by regulating MDMX-mouse double minute 2 homolog (MDM2) complex stability. Upon activation by either overexpression of a constitutively active vector or ligand binding (Neuregulin-1), Her4 was able to stabilize the MDMX-MDM2 complex, resulting in suppression of p53 transcriptional activity, as shown by p53-responsive element-driven luciferase assay and mRNA levels of p53 target genes. Using a phospho-proteomics approach, we functionally identified a novel Her4-induced posttranslational modification on MDMX at Ser-314, a putative phosphorylation site for the CDK4/6 kinase. Remarkably, inhibition of Ser-314 phosphorylation either with Ser-to-Ala substitution or with a specific inhibitor of CDK4/6 kinase blocked Her4-induced stabilization of MDMX-MDM2 and rescued p53 activity. Our study offers insights into the mechanisms of deregulated RTK-induced carcinogenesis and provides the basis for the use of inhibitors targeting RTKmediated signals for p53 restoration. p53 is either mutated or functionally inactive in most human cancers. Several tumor types that retain wild-type p53 (i.e. breast cancer) display higher protein levels of MDMX and/or MDM2 2 (1-8), the primary inhibitors of p53, representing alternative mechanisms of p53 inactivation. Typically, p53 protein levels are tightly controlled and modulated by its principle negative regulator, the MDMX-MDM2 complex. Given that MDMX and MDM2 are amplified in many tumors, modulation of their stability offers an attractive therapeutic strategy to restore p53 function and so improve tumor responsiveness to DNA-damaging therapy.Although MDM2 is the main negative regulator of p53, there is now growing evidence supporting the notion that MDMX also plays a key role in modulating p53, mainly through its stabilization of MDM2 (9). In fact, the MDMX-MDM2 heterocomplex is the main form in which the two proteins are found in the cell (10, 11), and loss of this formation leads to p53 activation and embryonic lethality (9, 11-13).Under non-stressed conditions, MDMX and MDM2 suppress p53 activity. However, under stress conditions, MDMX and MDM2 are posttranslationally modified and disabled for their inhibition of p53. As a result, p53 can then respond to the stress and repair any damage. MDM2 and MDMX are structural homologs, with the major distinction that MDM2 contains an E3 ligase domain, a nuclear localization signal domain, and a nuclear export signal domain (14). There are two major ways in which p53 activity can be suppressed by the complex. First, MDM2 and MDMX can cooperatively bind to the transactivational domain of p53 and suppress its transcriptional activity. Second, MDM2 can act as an E3 ligase and induce p53 ubiquitination an...

show abstract

Section: Her4 Overexpression Stabilizes the Mdmx-mdm2 Complexmentioning

confidence: 99%

“…In fact, the MDMX-MDM2 heterocomplex is the main form in which the two proteins are found in the cell (10,11), and loss of this formation leads to p53 activation and embryonic lethality (9,(11)(12)(13).…”

mentioning

confidence: 99%

Human epidermal growth factor receptor 4 (Her4) Suppresses p53 Protein via Targeting the MDMX-MDM2 Protein Complex

Gerarduzzi¹,

Polo²,

Liu³

et al. 2016

Journal of Biological Chemistry

View full text Add to dashboard Cite

show abstract

“…Human Pla2g16: forward primer CCAGGTCAACAACAAACATGATG; reverse primer CCCGCTGGATGATTTTGC. GAPDH or RPLP0 genes were used as quantitative RT-PCR (qRT-PCR) internal controls (37). The murine p53 knockdown plasmid was reported previously (38).…”

Section: Methodsmentioning

confidence: 99%

Pla2g16 phospholipase mediates gain-of-function activities of mutant p53

Xiong¹,

Tu²,

Kollareddy

et al. 2014

Proc. Natl. Acad. Sci. U.S.A.

Self Cite

View full text Add to dashboard Cite

p53 R172H/+ mice inherit a p53 mutation found in Li-Fraumeni syndrome and develop metastatic tumors at much higher frequency than p53 +/− mice. To explore the mutant p53 metastatic phenotype, we used expression arrays to compare primary osteosarcomas from p53 R172H/+ mice with metastasis to osteosarcomas from p53 +/− mice lacking metastasis. For this study, 213 genes were differentially expressed with a P value <0.05. Of particular interest, Pla2g16, which encodes a phospholipase that catalyzes phosphatidic acid into lysophosphatidic acid and free fatty acid (both implicated in metastasis), was increased in p53 R172H/+ osteosarcomas. Functional analyses showed that Pla2g16 knockdown decreased migration and invasion in mutant p53-expressing cells, and vice versa: overexpression of Pla2g16 increased the invasion of p53-null cells. Furthermore, Pla2g16 levels were increased upon expression of mutant p53 in both mouse and human osteosarcoma cell lines, indicating that Pla2g16 is a downstream target of the mutant p53 protein. ChIP analysis revealed that several mutant p53 proteins bind the Pla2g16 promoter at E26 transformationspecific (ETS) binding motifs and knockdown of ETS2 suppressed mutant p53 induction of Pla2g16. Thus, our study identifies a phospholipase as a transcriptional target of mutant p53 that is required for metastasis. mammary tumor | fatty acid metabolism T he p53 tumor suppressor pathway is inactivated in ∼50% of human cancers (http://p53.iarc.fr). Missense mutations in particular account for 80% of p53 alterations, suggesting that mutant p53 proteins provide additional advantages for tumor cell growth (1). Li-Fraumeni syndrome patients with p53 missense mutations have a higher cancer incidence and an earlier age of tumor onset than individuals with truncating or splicing mutations (2). p53 knockin mice show a gain-of-function (GOF) phenotype in vivo, with high metastatic capacity compared with mice inheriting a p53-null allele (3, 4). GOF activities of mutant p53 are mediated by suppression of the p53 family members, p63 and p73 (3-6). Other mechanisms of mutant p53 GOF include mutant-p53 complexes with Smad that fuel TGF-β-induced metastasis (7) and integrin recycling (8). Additionally, mutant p53 interacts with the vitamin D receptor and converts vitamin D into an antiapoptotic agent (9-14). More recently, mutant p53 was reported to form transcriptional complexes on promoters of genes encoding several enzymes of the Mevalonate pathway, which increases metastasis of breast cancer cells (9). These data suggest multiple pathways contribute to the GOF phenotypes of cells with mutant p53. Although mutant p53 lacks sequencespecific DNA binding activity, its interaction with other transcriptional factors or the components of basic transcriptional machinery allow it to modulate gene expression (15). ChIP-onchip and ChIP-sequencing techniques show that mutant p53 affects transcription of many genes (9, 13, 16, 17).In this study, expression array analyses identified gene differences between p53 R172H/+ m...

show abstract

“…The rescue of Mdm4 knockout and Mdm4 RING domain mutant mice by p53 deficiency concluded that Mdm4 has a non-overlapping function of Mdm4 with Mdm2. 12,13,19 However, this conclusion is difficult to reconcile with the finding that an Mdm2 transgene containing Mdm2 gene and its native promotor can completely rescue Mdm4-deficiency-induced p53-dependent lethality, leading to a conclusion that Mdm2 and Mdm4 are functionally overlapping in development. 28 Based on our biochemical model, it is higly likely that the Mdm2 splice isoforms expressed from the Mdm2 transgene, rather than the overexpression of full-length Mdm2 per se, may have compensated for the loss of Mdm4 as a RING-domain stimulater of full length Mdm2 activity to fully suppress p53 during development.…”

Section: Mdm2 Isoforms Are Super Active E3 Ligase For Ubiquitination mentioning

confidence: 99%

“…10 Mouse genetics studies indicated that RING-RING interaction of Mdm2-Mdm4 domain is essential for restricting p53 activity during embryonic development, since mutation of either Mdm2 or Mdm4 RING domain causes p53-dependent embryonic lethality. [11][12][13] Mdm2 alternative splice isoforms were reported years ago. 14 Two major splice isoforms Mdm2-A and Mdm2-B (referred thereafter as Mdm2-A/B) do not bind to p53 and induce p53-independent cell growth in vivo and tumorigenesis in vivo.…”

Section: Introductionmentioning

confidence: 99%

Mdm2 Splice isoforms regulate the p53/Mdm2/Mdm4 regulatory circuit via RING domain-mediated ubiquitination of p53 and Mdm4

Fan

Wang

2017

Cell Cycle

View full text Add to dashboard Cite

ABSTRACTp53 is regulated by heterodimer E3 ligase Mdm2-Mdm4 via RING domain interaction. Mdm2 transcripts undergo alternative splicing, and Mdm2 splice isoforms are increased in cancer and induced by DNA damage. Although 2 major Mdm2 splice isoforms that do not bind to p53 were reported to impact the p53 pathway, the underlying biochemical mechanisms were not understood. Here, we show that these Mdm2 splice isoforms ubiquitinate Mdm2 and Mdm4 in vivo and regulate the activity of Mdm2-Mdm4 E3 complex in cells. The Mdm2 isoforms are capable of promoting p53 ubiquitination in the absence of Mdm2 or Mdm4. The 2 isoforms stimulate Mdm2 or Mdm4 activity for p53 ubiquitination in vivo and promote degradation of p53 and Mdm4 in cells. However, the Mdm2 isoforms have opposing effects on the steady-state p53 levels depending on the stoichiometric ratios of Mdm2, Mdm4 and the isoforms, causing either decreased or increased p53 levels in cells. Our data indicate that the Mdm2 splice isoforms can act as independent E3 ligases for p53 when Mdm2 and Mdm4 are absent, form potent heterodimer E3 ligases with either Mdm2 or Mdm4 for targeting p53 degradation, or act as inhibitory regulators of Mdm2-Mdm4 E3 ligase activity by downregulating Mdm4. These findings suggest that Mdm2 splice isoforms may play critical roles in the regulatory loop of p53/Mdm2-Mdm4 via a RING domain-mediated biochemical mechanism.

show abstract

Heterodimerization of Mdm2 and Mdm4 is critical for regulating p53 activity during embryogenesis but dispensable for p53 and Mdm2 stability

Cited by 120 publications

References 37 publications

Human epidermal growth factor receptor 4 (Her4) Suppresses p53 Protein via Targeting the MDMX-MDM2 Protein Complex

Human epidermal growth factor receptor 4 (Her4) Suppresses p53 Protein via Targeting the MDMX-MDM2 Protein Complex

Pla2g16 phospholipase mediates gain-of-function activities of mutant p53

Mdm2 Splice isoforms regulate the p53/Mdm2/Mdm4 regulatory circuit via RING domain-mediated ubiquitination of p53 and Mdm4

Contact Info

Product

Resources

About