Heterogeneous nuclear ribonucleoprotein K promotes cap-independent translation initiation of retroviral mRNAs

Abstract

Translation initiation of the human immunodeficiency virus-type 1 (HIV-1) genomic mRNA (vRNA) is cap-dependent or mediated by an internal ribosome entry site (IRES). The HIV-1 IRES requires IRES-transacting factors (ITAFs) for function. In this study, we evaluated the role of the heterogeneous nuclear ribonucleoprotein K (hnRNPK) as a potential ITAF for the HIV-1 IRES. In HIV-1-expressing cells, the depletion of hnRNPK reduced HIV-1 vRNA translation. Furthermore, both the depletion and overexpression of hnRNPK modulated HIV-1 IRES activity. Phosphorylations and protein arginine methyltransferase 1 (PRMT1)-induced asymmetrical dimethylation (aDMA) of hnRNPK strongly impacted the protein's ability to promote the activity of the HIV-1 IRES. We also show that hnRNPK acts as an ITAF for the human T cell lymphotropic virus-type 1 (HTLV-1) IRES, present in the 5′UTR of the viral sense mRNA, but not for the IRES present in the antisense spliced transcript encoding the HTLV-1 basic leucine zipper protein (sHBZ). This study provides evidence for a novel role of the host hnRNPK as an ITAF that stimulates IRES-mediated translation initiation for the retroviruses HIV-1 and HTLV-1.

The Mytilus chilensis Steamer-like Element-1 Retrotransposon Antisense mRNA Harbors an Internal Ribosome Entry Site That Is Modulated by hnRNPK

“…This is also clear in the RTA analysis ( Figure 8 F). Taken together, the gain and loss of function experiments indicate that as for the HIV-1 IRES [ 41 ], hnRNPK is a positive ITAF for the Mch SLE-1 IRES.…”

“…Taking into consideration that retroviral mRNAs are naturally generated in the nucleus and that the activity of retroviral IRESs depends on IRES trans-activating factors (ITAFs) [ 14 , 61 , 62 ], we decided to evaluate the effect of heterogeneous nuclear ribonucleoprotein K (hnRNPK) on the activity of the Mch SLE-1 IRES. hnRNPK is an ITAF of the picornaviral IRES of FMDV [ 63 ] and has been recently described as a retroviral IRES ITAF [ 41 ].…”

“…In our case, the requirement of this nuclear experience by the Mch SLE-1 IRES led us to evaluate the effect of nucleus-cytoplasm shuttling proteins like hnRNPK on Mch SLE-1 IRES activity. hnRNPK has been described as an IRES trans-acting factor (ITAF) for picornaviruses [ 74 , 75 ], flaviviruses [ 63 , 76 ] and retroviruses [ 41 ]. In this study, we demonstrate that hnRNPK positively modulates the activity of the SLE-1 IRES ( Figure 8 ).…”

“…The plasmids dl HIV-1 IRES, dl HCV IRES, dl ∆EMCV, Glo-FLuc, pFMDV-Leader Protease, pmusHBZ FLuc and pCMV-HA-hnRNPK were kindly provided by Dr. Marcelo López-Lastra (Pontificia Universidad Católica de Chile) and have been previously described [ 28 , 37 , 38 , 39 , 40 , 41 ]. To generate the SLE-1 dual-luciferase (dl) bicistronic vector, dl SLE-1 5′UTR sense, the SLE-1 5′UTR sense was amplified by PCR from the M. chilensis genome, using the primers SLE1_5UTR_S_EcoRI_F (5′AAATTTGAATTCACAATGTAGACTAACCATGCTG 3′) and SLE1_5UTR_S_AUG1_NcoI_R (5′ AAATTTCCATGGCGGGTTTTAACATCTGACACC 3′), designed using the Mch SLE-1 sequence deposited at NCBI (OR712106).…”

“…For endogenous hnRNPK silencing, the HeLa cells seeded in 24-well plates were co-transfected using Lipofectamine 2000, with 200 ng of dl SLE-1 5′UTR AS and 20 nM of Dicer-Substrate siRNA targeting the 3′UTR of the hnRNPK mRNA [ 41 ] or a scrambled siRNA as the negative control. Both siRNAs were kindly provided by Dr. Marcelo López-Lastra (Pontificia Universidad Católica de Chile).…”