Heterologous Production of Clostridium cellulovorans engB , Using Protease-Deficient Bacillus subtilis , and Preparation of Active Recombinant Cellulosomes

Abstract

In cellulosomes produced by Clostridium spp., the high-affinity interaction between the dockerin domain and the cohesin domain is responsible for the assembly of enzymatic subunits into the complex. Thus, heterologous expression of full-length enzymatic subunits containing the dockerin domains and of the scaffolding unit is essential for the in vitro assembly of a "designer" cellulosome, or a recombinant cellulosome with a specific function. We report the preparation of Clostridium cellulovorans recombinant cellulosomes containing the enzymatic subunit EngB and the scaffolding unit, mini-CbpA, containing a cellulose binding domain, a putative cell wall binding domain, and two cohesin units. The full-length EngB containing the dockerin domain was expressed by Bacillus subtilis WB800, which is deficient in eight extracellular proteases, to prevent the proteolytic cleavage of the enzymatic subunit between the catalytic and dockerin domains that was observed in previous attempts to express EngB with Escherichia coli. The assembly of recombinant EngB with the miniCbpA was confirmed by immunostaining, a cellulose binding experiment, and native polyacrylamide gel electrophoresis analysis.Clostridium cellulovorans produces a cellulase enzyme complex (cellulosome) containing a variety of cellulolytic subunits attached to the nonenzymatic component termed CbpA (2). All cellulosomal enzymatic subunits contain a twice-repeated sequence, usually at their C termini, called the dockerin domain. These dockerin domains are considered to bind to the hydrophobic domains termed cohesins (19,26), which are repeated nine times in CbpA (14). So far, we have cloned and sequenced eight cellulosomal cellulase genes from C. cellulovorans (engB [3] [17], and exgS [9]). In addition, the genes for cellulosomal mannanase (manA) (15) and pectate lyase (pelA) (17) have also been cloned and sequenced.In order to understand the hydrolytic mechanism of the cellulosome and to use cellulosomes for industrial purposes, it is very important to make recombinant cellulosomes, or "designer" cellulosomes, with specific functions. To prepare recombinant cellulosomes, it is necessary to express the cellulosomal enzyme subunits that retain their dockerin domains. Escherichia coli is a very efficient host for expression of heterologous genes. However, during the expression of cellulosomal subunits from C. cellulovorans by E. coli, we found that almost all recombinant enzyme proteins were partially degraded between the catalytic and dockerin domains by the proteases of E. coli. Thus, this problem prevented us from preparing recombinant cellulosomes.As a host for heterologous expression, Bacillus subtilis has many attractive features (21). These features include the ability to secrete extracellular proteins, ease of genetic manipulation, and fast growth. However, one major problem is the presence of high levels of extracellular proteases. Aminov et al. (1) tried to express the celE gene, encoding one of the cellulosomal subunits from Clostridium thermocellum, ...

Synergistic Effects on Crystalline Cellulose Degradation between Cellulosomal Cellulases fromClostridium cellulovorans

“…The purified mini-CbpA (5.0 nmol) and the recombinant cellulosomal cellulases (ExgS, EngE, or EngH, 10 nmol) were mixed in 100 l of the binding buffer (25 mM sodium-acetic buffer [pH 6.0], 15 mM CaCl 2 ), and kept for 1 h at 4°C. The assembly of mini-CbpA and cellulolytic subunits was confirmed by native PAGE analysis by use of 4 to 15% or 10% ready-made gel (Bio-Rad) as described previously (26).…”

“…Not all of these proteins possessed their own signal peptides, and they were designed to fuse the PelA signal peptide at their N-terminal ends and the His tag at their C-terminal ends from pET-22b. The mini-cbpA gene and the engE gene were amplified by PCR and inserted into the NcoI and XhoI sites of the pET-22b vector to generate pET-22b-mini-CbpA and pENGE as described previously (19,26). For construction of the ExgS production vector, the exgS gene was amplified by PCR with the genomic DNA from C. cellulovorans as a template with the primers exgS F (CAAGTTTCCATGGCACCAGTAGTGCCAAATAATGAG) and exgS B (GGGGGCTCGAGAGCAAGAAGTGCTTTCTTTAATAAGC).…”

“…The mini-CbpA contained one cellulose binding domain, one hydrophilic domain, and two cohesin domains as designated previously (26). Since one cohesin domain binds one cellulosomal enzyme, one mini-CbpA could bind at most two cellulosomal enzymes.…”

Exploring Amino Acids Responsible for the Temperature Profile of Glycoside Hydrolase Family 45 Endoglucanase EGL3 fromHumicola grisea

“…Recombinant cellulases are sometimes degraded at the linker region by the host's proteinases. 19,20) Hence we concluded that the recombinant proteins were degraded to CADs with heterologous lengths of the linker during the cultivation period, and that the linker was cut off during the purification procedure.…”

Recombinant Cellulase and Cellulosome Systems

“…Another attractive host towards the production of recombinant cellulosomes is B. subtilis, since it can be easily genetically manipulated, is characterized by fast growth, and is an efficient protein secretor. A strain of B. subtilis deficient in eight major extracellular proteases, B. subtilis WB800, was engineered and used as a host for the production and secretion of C. cellulovorans EngE since this enzyme was shown to be partially degraded in E. coli [105]. Murashima and colleagues were successful in using this protease-deficient strain to produce EngE, and subsequent incubation with scaffold Mini-CbpA, which contains a CBD as well as two cohesins, resulted in assembly of an enzyme-scaffold complex capable of binding cellulose [105].…”