High-Frequency Phenotypic Reversion and Pathogenicity of an Acyclovir-Resistant Herpes Simplex Virus Mutant

Abstract

A double-guanine-insertion mutation within a run of guanines in the herpes simplex virus gene encoding thymidine kinase (TK) was previously found in an acyclovir-resistant clinical isolate. This mutation was engineered into strain KOS, and stocks were generated from single plaques. Plaque autoradiography revealed that most plaques in such stocks exhibited low levels of TK activity, while ϳ3% of plaques exhibited high levels of TK activity, indicating a remarkably high frequency of phenotypic reversion. This virus was able to reactivate from latency in mouse ganglia; a fraction of the reactivating virus expressed a high level of TK activity due to an additional G insertion, suggesting that the observed genetic instability contributed to pathogenicity.Herpes simplex virus (HSV) thymidine kinase (TK) activates a number of highly effective antiviral drugs, such as acyclovir (ACV); however, resistance to these drugs can hamper therapy. It has been estimated that ACV-resistant (ACV r ) disease occurs in ϳ5% of immunocompromised patients undergoing antiviral treatment (3, 9). The most common mutations in isolates from these patients occur on homopolymeric sequences in tk, especially on a run of 7 guanine (G) bases (G string) (12,24,27). Isolates that contain a single-G insertion within the G string express a low level of full-length active TK as the result of a ribosomal frameshift (16,17). This observation provoked the hypothesis that the low levels of TK synthesized by these ACV r isolates were sufficient to permit disease but inadequately activate ACV. Less frequently, ACV r isolates containing insertions of two Gs within the G string have been recovered (12). Interestingly, one of these viruses has been described previously as expressing low levels of TK (12). We wanted to examine the effect of this mutation on TK expression, and on viral latency in a mouse model of HSV infection, by engineering the mutation into a well-studied laboratory strain, KOS.Construction of recombinant virus TKG7؉2G. As an initial step in the engineering, a double-G-insertion mutant, plasmid pTKG7ϩ2G, was constructed from plasmid pAG5, which contains the entire BamHI P fragment of HSV-1 strain KOS in pBluescript SKϩ (Promega) such that tk is in the same orientation as the T7 promoter. The wild-type sequence G 7 was mutated to G 9 , using two complementary oligonucleotides with the sequence CTGGCTCCTCATATCGGGGGGGGGAGG CTGGGAGCT (only the forward primer is shown) and a sitedirected mutagenesis kit (QuickChange; Stratagene) according to the manufacturer's instructions. Correct introduction of the mutation was confirmed by sequencing through the mutation.To generate two independently isolated recombinant viruses (Fig. 1), plasmid midi-prep DNA (Wizard Prep; Promega) and infectious virion mini-prep (6) tkLTRZ1 DNA, together with transfection reagent (Effectene; Qiagen), were added to Vero cells previously seeded to be 50% confluent. tkLTRZ1, a recombinant virus made from laboratory strain KOS (7), contains an insertion within the tk gene of lac...

Differential importance of highly conserved residues in UL24 for herpes simplex virus 1 replication in vivo and reactivation

“…vUL24-eGFPb, vUL24-eGFPbRescue, vUL24-E99A/K101A-a and -b and vUL24-G121A-a and -b are described elsewhere (Bertrand et al, 2010). Briefly, to make vUL24-eGFPb, KOS-infectious DNA was co-transfected with the linearized transfer vector pBamHIQeGFP; to make the rescue virus, vUL24-eGFPb infectious DNA was co-transfected with the linearized vector pAG5 (Griffiths & Coen, 2003); and to make the substitution mutants, vUL24-eGFPb infectious DNA was co-transfected with either the linearized vector pKOS-UL24-E99A/K101A or pKOS-UL24-G121A. Each of the transfer vectors contains the BamHI Q fragment of the KOS genome in the plasmid pSK+.…”

Characterization of a neurovirulent aciclovir-resistant variant of herpes simplex virus

“…Since the submission of this paper, Griffiths & Coen (2003) (J Virol 77, 2282(J Virol 77, -2286(J Virol 77, , 2003 have described the genetic engineering of a double guanine insertion into the G-string region of the TK gene-encoding region of wild-type HSV-1 strain KOS. The majority of plaques isolated from stocks of this virus had a TK-negative phenotype, yet approximately 3 % of plaques had high levels of TK activity.…”

Translational Compensation of a Frameshift Mutation Affecting Herpes Simplex Virus Thymidine Kinase Is Sufficient To Permit Reactivation from Latency

“…1) and infectious DNA from mutant virus tkLTRZ1, which is TK Ϫ due to an insertion of lacZ driven by a strong promoter into tk, as described previously (14). Briefly, recombinant viruses were isolated following limiting dilution in 96-well dishes; wells were screened for a single white plaque following staining for ␤-galactosidase activity with X-Gal (5-bromo-4-chloro-3-indolyl-␤-D-galactopyranoside) and counterstaining with neutral red, as described previously (15).…”

“…p294⌬TK was made by digesting pBH15 (which contains the tk gene from virus 294.1 [18]) with SnaBI and PstI, blunt ending with T4 DNA polymerase, and then recircularizing. Plasmid pAG5 (14) contains the BamHI P fragment of HSV-1 KOS cloned into pBluescript SK(ϩ) (Promega, Madison, Wis.) such that tk is in the same orientation as the T7 promoter. Plasmid pAG6.TKG7ϩ1G was made by introducing the G 7 ϩ1G mutation into pAG5 with the QuikChange kit (Stratagene, La Jolla, Calif.) according to the manufacturer's instructions by using two complementary oligonucleotides (Integrated DNA Technologies, Coralville, Iowa); however only the forward primer is listed here: CTGGCTCCTC ATATCGGGGGGGGAGGCTGGGAGCTC.…”