High Mobility Group Box2 Promoter-controlled Suicide Gene Expression Enables Targeted Glioblastoma Treatment

Abstract

Achievement of specific tumor cell targeting remains a challenge for glioma gene therapy. We observed that the human high mobility group box2 (HMGB2) gene had a low level of expression in normal human brain tissues, but was significantly upregulated in glioblastoma tissues. With progressive truncation of a 5'-upstream sequence of the HMGB2 gene, we identified a 0.5-kb fragment displaying a high transcriptional activity in glioblastoma cells, but a low activity in normal brain cells. To test the feasibility of using the HMGB2 promoter sequence in targeted cancer therapy, we constructed a baculoviral vector expressing the herpes simplex virus thymidine kinase (HSVtk) gene driven by the HMGB2 promoter. Transduction with the viral vector induced cell death in glioblastoma cell lines in the presence of ganciclovir (GCV), but did not affect the survival of human astrocytes and neurons. In a mouse xenograft model, intratumor injection of the baculoviral vector suppressed the growth of human glioblastoma cells and prolonged the survival of tumor-bearing mice. Our results suggest that the novel 5' sequence of HMGB2 gene has a potential to be used as an efficient, tumor-selective promoter in targeted vectors for glioblastoma gene therapy.

Development of the hybrid Sleeping Beauty-baculovirus vector for sustained gene expression and cancer therapy

“…13--15 The baculovirus expressing the herpes simplex virus thymidine kinase repressed the growth of human glioblastoma in the presence of ganciclovir and prolonged the mouse survival; yet, the tumors were not completely regressed partly due to the transient herpes simplex virus thymidine kinase expression. 16 To combat the prostate cancer, we constructed a baculovirus expressing hEA (Bac-hEA) and proved the antiangiogenic functions. Intratumoral injection of Bac-hEA into the prostate tumor grafts in mice attenuated the angiogenesis and tumor growth and extended the life span of animals.…”

Baculovirus-transduced bone marrow mesenchymal stem cells for systemic cancer therapy

“…The stable U87 cell clone expressing luciferase gene (U87-luc) was generated as described previously. 21 Briefly, U87 cells were seeded in a six-well plate at a density of 5 Â 10 5 cells per well and transfected with pRC-CMV2-luc plasmid using Lipofectamine 2000 (Invitrogen, Carlsbad, CA, USA). After 1 day, transfected cells were transferred to a 100-mm cellculture dish and 1 mg ml À1 geneticin was added to the medium to select the resistant cells.…”

“…To generate the recombinant baculovirus vector containing the herpes simplex virus thymidine kinase (HSVtk) gene, the HSVtk gene with flanking EcoRI and XhoI sites was obtained through PCR amplification from the pORF-HSVtk plasmid (InvivoGen, San Diego, CA, USA) using forward primer 5 0 -GTGAACCGTCAGATCGAATTCCTGAGA TCACCGGCGAAGGA-3 0 and reverse primer 5 0 -CCAG AGGTTGATTATCGCTCGAGTCAGTTAGCCTCCC CCATCT-3 0 , and used to replace the eGFP gene in our CMV-W vector. 21 BacPAK6, a baculoviral vector without a mammalian gene expression cassette, was purchased from Clontech (Mountain View, CA, USA).…”

High-mobility group box 2 (HMGB2) modulates radioresponse and is downregulated by p53 in colorectal cancer cell

“…14 HMGB2 have been significantly upregulated in glioblastoma tissues, compared with a low level of expression in normal human brain tissues. 15 In hepatocellular carcinoma, HMGB2 overexpression has been significantly correlated with shorter overall survival time. 16 Despite extensive characterization of the diverse roles of HMGB1, relatively less is known of the specific biological function of HMGB2.…”