High-resolution analysis of salmonellae from turtles within a headwater spring ecosystem

Abstract

Sediments and water from the pristine headwaters of the San Marcos River, Texas, USA, as well as swabs from biofilms on the carapace and from the cloacae of 17 musk turtles (Sternotherus odoratus) and one snapping turtle (Chelydra serpentina serpentina) caught at the same site, were analysed for salmonellae by culture and molecular techniques. Whereas enrichment cultures from sediment and water samples were negative for salmonellae in PCR- and in situ hybridization-based analyses, both techniques detected salmonellae after enrichments from both carapace and cloacae of nine (i.e. of 53%) musk turtles. Further characterization of 10 isolates obtained from the enrichment cultures of four selected individuals and confirmed as salmonellae by PCR analysis was achieved by fingerprinting techniques (rep-PCR). The results show differences between individuals and, in one case, variation among isolates from a single individual. All isolates from two individuals displayed identical profiles. These profiles were different from those obtained from the isolates of the third individual, which were, themselves, also identical for all isolates. Salmonellae were much more diverse in samples from the carapace of the last individual with five different rep-PCR profiles retrieved. Serotyping of seven isolates representative for each rep-PCR profile identified all isolates as representing Salmonella enterica subspecies enterica serotype Rubislaw, which demonstrates the presence of different strains of potentially human pathogenic salmonellae naturally occurring on turtles even within pristine environments. The frequent detection of these organisms in biofilms on the carapace opens the door for speculations on the role of this habitat as a reservoir for salmonellae, and on potential implications for turtles acting as a dispersal vector.

Detection of Salmonella in Gopher Tortoises (Gopherus polyphemus) During Two Relocation Efforts in Florida

“…These results are similar to studies that examined commercial freshwater turtles from the United States (Shane et al 1990) and Belgium (Pasmans et al 2002) as well as captive and household tortoises from Italy (Corrente et al 2004) and wild gopher tortoises from Georgia (Lockhart et al 2008). The prevalence seen here is not as high as in some other studies (Briones et al 2004;Hahn et al 2007;Hildago-Vila et al 2007), and some factors have been proposed to explain the differences. There has been debate over which method most reliably tests for the presence of Salmonella and that poor technique may be the cause of low prevalence results in some studies (Hahn et al 2007).…”

“…This is because Salmonella not only lives in the intestinal tract but can penetrate developing turtle eggs, leading to infection at hatching (Feeley and Treger 1969;Kaufmann et al 1972). Salmonella can also be cultured from sites outside of the host (Bauwens et al 2006;Hahn et al 2007), and direct contact is probably not necessary for transmission (CDC 1990;Friedman et al 1998;Winfield and Groisman 2003).…”

Recovery of Salmonella from biofilms in a headwater spring ecosystem

“…Salmonella were detected in water, biofilm and crayfish samples from Spring Lake, San Marcos, TX, after semi-selective enrichment and subsequent detection on invA gene fragments by PCR as described previously (Hahn et al 2007). Although only about 3% of all samples were found to be positive for salmonellae, their detection is of importance since Spring Lake is generally considered one of the most pristine waters in Texas (Slattery & Fahlquist 1997).…”

“…This protocol has been acknowledged as the international standard diagnostic method for quality assurance laboratories in epidemiological studies on all Salmonella entérica subspecies as well as in Salmonella bongori (Malorny et al 2003). Aliquots of the final enrichment were centrifuged at 14,000 rpm for 2 min, the bacterial pellets washed once in sterile distilled water, and the bacteria lysed in 100 ^L of 50 mM NaOH by incubation at 65 °C for 15 min (Hahn et al 2007). One microliter of lysate was used as template for PCR amplification with primers 139 (5'GTGAAATTATCGCCACGTTCGGGCAA3') and 141 (5'TCATCGCACCGTCAAAGGAACC3') (Rahn et al 1992) in a final volume of 50 |iL containing 1 x PCR buffer (50 mM KCl, 2.5 mM MgClz, 20 mM Tris/HCI, pH 8.4, 0.1% Triton 100), 0.2 mM dNTPs, 1 U of Tag polymerase, and 100 ng of each primer.…”

“…fish, turtles) and biofilms even in supposedly clean habitats such as Spring Lake, the spring-fed headwaters of the San Marcos River in San Marcos, Texas (Hahn et al 2007;Gaertner et al 2008aGaertner et al , b, 2009. Spring Lake is a small reservoir (6 ha) that is considered one of the most pristine waters in Texas (Slattery & Fahlquist 1997).…”