High-resolution melting analysis for rapid and sensitive NOTCH1 screening in chronic lymphocytic leukemia

Xu, Jingjing; Yao, Fei; Jiang, Min; Zhang, Youtao; Guo, Feng

doi:10.3892/ijmm.2017.2849

Cited by 6 publications

(4 citation statements)

References 50 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…Direct sequencing identified 6 samples that harbored the MYD88 p.L256P mutation, and was consistent with the results of the HRM assay. The mutation frequency was similar to that found in previous studies using other assay methods (28)(29)(30). The HRM analysis in the present study was highly sensitive, and was able to detect a mutation rate of 1%.…”

Section: Discussionsupporting

confidence: 90%

See 1 more Smart Citation

High‑resolution melting analysis for rapid and sensitive MYD88 screening in chronic lymphocytic leukemia

Jiang

Zhou

et al. 2019

Oncol Lett

Self Cite

View full text Add to dashboard Cite

High resolution melting (HRM) assay is a novel technology for the fast, high-throughput, sensitive, post-PCR analysis of genetic mutations. Myeloid differentiation primary response 88 (MYD88) mutations are frequently reported in chronic lymphocytic leukemia (CLL) and confer a worse prognosis. The objective of the present study was to assess the value of HRM analysis for the rapid screening of MYD88 mutations in patients with CLL. Genomic DNA samples were extracted from the bone marrow of 129 newly diagnosed patients with CLL. A plasmid with an MYD88-L265P mutation was constructed, and the p.L265P substitution, which is the predominant MYD88 mutation in CLL, was detected using HRM analysis and direct sequencing. The plasmid pCMV-MYD88-L265P-Mu was successfully constructed as a positive control, and was verified by direct sequencing. The normalized and shifted melting curves of 6/129 (4.65%) samples were clearly different from those of other patients by HRM analysis. In addition, the 794T>C mutation in MYD88 was identified in 6 (4.65%) patients by direct sequencing. Sensitivity evaluation revealed that the HRM assay had a higher sensitivity (to 1% dilution) than direct sequencing, in addition to being convenient and time-saving. The MYD88 p.L256P mutation has been implicated to be associated with adverse prognosis in CLL. HRM analysis has the potential to be a routine prescreening technique to identify the MYD88 p.L256P mutation and may facilitate the clinical treatment of CLL.

show abstract

Section: Discussionsupporting

confidence: 90%

“…The HRM analysis in the present study was highly sensitive, and was able to detect a mutation rate of 1%. This indicates that the sensitivity of the HRM analysis was higher compared with that of direct sequencing analysis, with a sensitivity of 10% (30,31).…”

Section: Discussionmentioning

confidence: 97%

High‑resolution melting analysis for rapid and sensitive MYD88 screening in chronic lymphocytic leukemia

Jiang

Zhou

et al. 2019

Oncol Lett

Self Cite

View full text Add to dashboard Cite

show abstract

“…Our data suggest that cell treatment by chidamide could activate general anti-oncogenic mechanisms. To investigate both NOTCH1-dependent and independent anti- MOLT-4 cells harbor a deletion of a CT dinucleotide in the PEST domain of the NOTCH1 (heterozygous for c.7541_7542delCT [45]), and a mutation in HD domain of NOTCH1 (heterozygous mutation 1601 L!P) [46]. Jurkat cells bear an insertion of the 51 bp in exon 28 of NOTCH1 (c.5220_5221ins51 (CAGGCCGTGGAGCCGCCC-CCGCCGGCGCAGCTGCACTTCATGTACGTGGCG)), resulting in the insertion of 17 amino acids (p.1740_ 1741insQAVEPPPPAQLHFMYVA) in the extracellular juxtamembrane region of the NOTCH1 receptor [47,48].…”

Section: Chidamide Treatment Induces An Arrest Of the Cell Cycle In G...mentioning

confidence: 99%

Chidamide inhibits the NOTCH1-MYC signaling axis in T-cell acute lymphoblastic leukemia

Guo

Bayin

et al. 2021

Front. Med.

View full text Add to dashboard Cite

T-cell acute lymphoblastic leukemia (T-ALL) is one of the most dangerous hematological malignancies, with high tumor heterogeneity and poor prognosis. More than 60% of T-ALL patients carry NOTCH1 gene mutations, leading to abnormal expression of downstream target genes and aberrant activation of various signaling pathways. We found that chidamide, an HDAC inhibitor, exerts an antitumor effect on T-ALL cell lines and primary cells including an anti-NOTCH1 activity. In particular, chidamide inhibits the NOTCH1-MYC signaling axis by down-regulating the level of the intracellular form of NOTCH1 (NICD1) as well as MYC, partly through their ubiquitination and degradation by the proteasome pathway. We also report here the preliminary results of our clinical trial supporting that a treatment by chidamide reduces minimal residual disease (MRD) in patients and is well tolerated. Our results highlight the effectiveness and safety of chidamide in the treatment of T-ALL patients, including those with NOTCH1 mutations and open the way to a new therapeutic strategy for these patients.

show abstract

“…NOTCH1 mutations are frequent in CLL [9]. Encoding domains mutations, mainly in PEST (proline (P), glutamic acid (E), serine (S), threonine (T)-rich protein sequence) domain [10][11][12], are reported to occur in nearly 10% patients with CLL in Western countries [3,13,14]. The mutations increase with disease progression and drug resistance.…”

Section: Introductionmentioning

confidence: 99%

NOTCH1 mutation and its prognostic significance in Chinese chronic lymphocytic leukemia: a retrospective study of 317 cases

et al. 2018

View full text Add to dashboard Cite

The proto‐oncogene NOTCH1 is frequently mutated in around 10% of patients with chronic lymphocytic leukemia (CLL). This study analyzed NOTCH1 mutation status of 317 Chinese patients with CLL by Sanger sequencing. The frequencies of NOTCH1 mutation in the PEST (proline (P), glutamic acid (E), serine (S), threonine (T)‐rich protein sequence) domain and the 3′ untranslated regions (UTR) were 8.2% and 0.9%, with the most frequent mutation being c.7541_7542delCT and c.*371A>G, respectively. Clinical and biological associations were determined including NOTCH1 mutations with advanced stage (Binet stage, P = 0.010), unmutated immunoglobulin heavy‐chain variable region (IGHV) gene (P < 0.001) and trisomy 12 (+12) (P = 0.014). NOTCH1‐mutated patients had lower CD20 expression intensity than NOTCH1‐unmutated patients (P = 0.029). In addition, NOTCH1‐mutated patients had shorter overall survival (OS) (P = 0.002) and treatment‐free survival (TFS) (P = 0.002) than NOTCH1‐unmutated patients, especially for patients with NOTCH1 c.7541_7542delCT and/or c.*371A>G mutations. Patients with both mutated NOTCH1 and unmutated IGHV had shorter OS (P < 0.001) and TFS (P < 0.001) than those with unmutated NOTCH1 or mutated IGHV. These data provide a comprehensive view of the clinical relevance and prognostic impact of NOTCH1 mutations on Chinese patients with CLL.

show abstract

High-resolution melting analysis for rapid and sensitive NOTCH1 screening in chronic lymphocytic leukemia

Cited by 6 publications

References 50 publications

High‑resolution melting analysis for rapid and sensitive MYD88 screening in chronic lymphocytic leukemia

High‑resolution melting analysis for rapid and sensitive MYD88 screening in chronic lymphocytic leukemia

Chidamide inhibits the NOTCH1-MYC signaling axis in T-cell acute lymphoblastic leukemia

NOTCH1 mutation and its prognostic significance in Chinese chronic lymphocytic leukemia: a retrospective study of 317 cases

Contact Info

Product

Resources

About