High-Resolution STM Imaging of Novel Single G4-DNA Molecules

Shapir, Errez; Sagiv, Lior; Borovok, Natalia; Molotski, Tatiana; Kotlyar, Alexander; Porath, Danny

doi:10.1021/jp803478f

Cited by 38 publications

(61 citation statements)

References 34 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…1.5 nm (see height profile on Figure 3d). This height—though shorter than expected—is not only in accord with previously reported STM images of porphyrin-only nanowires prepared from porphyrin 3 metalated with zinc, 40 but is also in accord with previously reported AFM (∼1.6 nm) 38 and STM (∼1.5 nm) 51 data of conventional guanine wires. Furthermore, soft nanomaterials assembled from DNA and/or cyclodextrins typically exhibit lower measured heights when imaged on a surface due to various artifacts including high humidity, indentation of the assembly by the tip, and substrate induced flattening.…”

Section: Resultssupporting

confidence: 92%

“…Furthermore, soft nanomaterials assembled from DNA and/or cyclodextrins typically exhibit lower measured heights when imaged on a surface due to various artifacts including high humidity, indentation of the assembly by the tip, and substrate induced flattening. 51–53 In this case, the decreased height of nanowire 4 is thought to be due to a combination of the abovementioned artifacts and nanowire flexibility.…”

Section: Resultsmentioning

confidence: 98%

See 1 more Smart Citation

Photonic DNA-Chromophore Nanowire Networks: Harnessing Multiple Supramolecular Assembly Modes

et al. 2013

View full text Add to dashboard Cite

Photonic DNA nanostructures are typically prepared by the assembly of multiple sequences of long DNA strands that are conjugated covalently to various dye molecules. Herein we introduce a non-covalent method for the construction of porphyrin-containing DNA nanowires and their networks that uses the programmed assembly of a single, very short, oligodeoxyribonucleotide sequence. Specifically, our strategy exploits a number of supramolecular binding modalities (including DNA base-pairing, metal-ion coordination, and β-cyclodextrin-adamantane derived host-guest interactions) for simultaneous nanowire assembly and porphyrin incorporation. Furthermore, we also show that the resultant DNA-porphyrin assembly can be further functionalized with a complementary “off-the-shelf” DNA binding dye resulting in photonic structures with broadband absorption and energy transfer capabilities.

show abstract

Section: Resultssupporting

confidence: 92%

Section: Resultsmentioning

confidence: 98%

Photonic DNA-Chromophore Nanowire Networks: Harnessing Multiple Supramolecular Assembly Modes

et al. 2013

View full text Add to dashboard Cite

show abstract

“…In contrast, structures such as G4-DNA [44-48], frayed wires [49-51], and G-wires [46] are driven only by Hoogsteen hydrogen bonding in G-quartets. Canonical base pairing has been used to create duplex DNA branches on the ends of frayed wires [49], but initial assembly of the frayed wires exploits only Hoogsteen hydrogen bonding and used a single DNA sequence, which does not allow significant variability/flexibility [49].…”

Section: Resultsmentioning

confidence: 99%

Synapsable quadruplex-mediated fibers

Méndez

Szalai

2013

Nanoscale Res Lett

View full text Add to dashboard Cite

We have fabricated a DNA-based nanofiber created by self-assembly of guanine quadruplex (Hoogsteen base pairing) and double-stranded DNA (Watson-Crick base pairing). When duplexes containing a long stretch of contiguous guanines and single-stranded overhangs are incubated in potassium-containing buffer, the preformed duplexes create high molecular weight species that contain quadruplexes. In addition to observation of these larger species by gel electrophoresis, solutions were analyzed by atomic force microscopy to reveal nanofibers. Analysis of the atomic force microscopy images indicates that fibers form with lengths ranging from 250 to 2,000 nm and heights from 0.45 to 4.0 nm. This work is a first step toward the creation of new structurally heterogeneous (quadruplex/duplex), yet controllable, DNA-based materials exhibiting novel properties suitable for a diverse array of nanotechnology applications.

show abstract

“…Subsequently, ultrafast energy transfer among the bases takes place on the femtosecond time scale. However, these conclusions were drawn from studying tetramolecular G-quadruplexes (10)(11)(12) and very long guanine wires (18), prepared for applications in molecular electronics (19,20).…”

Section: Introductionmentioning

confidence: 99%

Electronic Excitations in G‐quadruplexes Formed by the Human Telomeric Sequence: A Time‐Resolved Fluorescence Study

Changenet‐Barret

Yang

Gustavsson

et al. 2014

Photochem & Photobiology

View full text Add to dashboard Cite

The present study deals with G-quadruplexes formed by folding of the human telomeric sequence d(GGGTTAGGGTTAGGGTTAGGG), in presence of K(+) cations, noted Tel21/K(+) . Fluorescence decays and fluorescence anisotropy decays, obtained upon excitation at 267 nm, are probed from femtosecond to nanosecond domains using two different detection techniques, fluorescence upconversion and time-correlated single photon counting. The results are discussed in light of recent theoretical studies. It is shown that efficient energy transfer takes place among the bases on the femtosecond time scale, possible only via exciton states. The major part of the fluorescence originates from bright excited states having weak charge transfer character and decaying between 1 and 100 ps. Charge transfer states involving guanines in different tetrads decay mainly after 100 ps and emit at the red wing of the spectrum. The persistence of electronic excitations in Tel21/K(+) is longer and the contribution of charge transfer states is more pronounced than what is observed for G-quadruplexes formed by association of four d(TGGGT) strands and containing the same number of tetrads. This difference is due to the increased structural rigidity of monomolecular structures which reduces nonradiative deactivation pathways and favors collective effects.

show abstract

High-Resolution STM Imaging of Novel Single G4-DNA Molecules

Cited by 38 publications

References 34 publications

Photonic DNA-Chromophore Nanowire Networks: Harnessing Multiple Supramolecular Assembly Modes

Photonic DNA-Chromophore Nanowire Networks: Harnessing Multiple Supramolecular Assembly Modes

Synapsable quadruplex-mediated fibers

Electronic Excitations in G‐quadruplexes Formed by the Human Telomeric Sequence: A Time‐Resolved Fluorescence Study

Contact Info

Product

Resources

About