High-Risk Human Papillomavirus Affects Prognosis in Patients With Surgically Treated Oropharyngeal Squamous Cell Carcinoma

Licitra, Lisa; Perrone, Francesco; Bossi, Paolo; Suardi, Simona; Mariani, Luigi; Artusi, R.; Oggionni, Maria; Rossini, Chiara; Cantù, Giulio; Squadrelli, Massimo; Quattrone, Pasquale; Locati, Laura D.; Bergamini, Cristiana; Olmi, Patrizia; Pierotti, Marco A.; Pilotti, Silvana

doi:10.1200/jco.2005.04.6136

Cited by 598 publications

(545 citation statements)

References 44 publications

Supporting

Mentioning

488

Contrasting

Unclassified

Order By: Relevance

“…1-6) as having usual, 8 as having malignant (nos. [7][8][9][10][11][12][13][14], and 10 as having dedifferentiated solitary fibrous tumors (nos. [15][16][17][18][19][20][21][22][23][24].…”

Section: Patients and Primary Tumorsmentioning

confidence: 99%

“…A total of 1 μg of RNA per sample was retrotranscribed as previously described. 14 The primers used to detect NAB2/STAT6 fusion products were the previously described NAB2ex5F (CCTGTCTGGGGAGAGTCTGGATG)/STAT6ex20R(GG GGGGATGGAGTGAGAGTGTG) 6 and NAB2ex21051F (GCCCGAGAGCACCTACTT)/STAT6ex4762R(AGGTG GATCTCCCCTACTTCG); 7 the polymerase chain reaction conditions have been described elsewhere. 7 After treatment with ExoSap IT (Affymetrix, Santa Clara, CA, USA), the amplified products were directly sequenced using a Big Dye v1.1 cycle sequencing kit and a 3500Dx genetic analyzer (Thermo Fisher Scientific, Waltham, MA, USA).…”

Section: Reverse-transcription Polymerase Chain Reaction and Sequencingmentioning

confidence: 99%

“…The antibody and immunohistochemistry procedure for the TP53 assessments have been described elsewhere. 14 RB1 immunohistochemistry was performed using the R PMG 3-245 clone (Pharmigen, BecktonDickenson, San Jose, CA, USA) as described above.…”

Section: Immunohistochemistrymentioning

confidence: 99%

“…15, 16, 17, 21b, 22a and b, 23a and b, and 24a and b) with suitable genomic DNA; exons 5-8 were amplified and sequenced as previously described. 14 …”

Section: Tp53 Mutational Analysismentioning

confidence: 99%

See 3 more Smart Citations

Solitary fibrous tumors: loss of chimeric protein expression and genomic instability mark dedifferentiation

et al. 2015

Self Cite

View full text Add to dashboard Cite

Solitary fibrous tumors, which are characterized by their broad morphological spectrum and unpredictable behavior, are rare mesenchymal neoplasias that are currently divided into three main variants that have the NAB2-STAT6 gene fusion as their unifying molecular lesion: usual, malignant and dedifferentiated solitary fibrous tumors. The aims of this study were to validate molecular and immunohistochemical/biochemical approaches to diagnose the range of solitary fibrous tumors by focusing on the dedifferentiated variant, and to reveal the genetic events associated with dedifferentiation by integrating the findings of array comparative genomic hybridization. We studied 29 usual, malignant and dedifferentiated solitary fibrous tumors from 24 patients (including paired samples from five patients whose tumors progressed to the dedifferentiated form) by means of STAT6 immunohistochemistry and (when frozen material was available) reverse-transcriptase polymerase chain reaction and biochemistry. In addition, the array comparative genomic hybridization findings were used to profile 12 tumors from nine patients. The NAB2/STAT6 fusion was detected in all of the tumors, but immunohistochemistry and western blotting indicated that chimeric protein expression was atypical or absent in 9 out of 11 dedifferentiated tumors. The comparative genomic hybridization results revealed that the usual and malignant solitary fibrous tumors had a simple profile, whereas the genome of the dedifferentiated tumors was complex and unstable, and suggested that 13q and 17p deletions and TP53 mutations may be present in malignant lesions before the full expression of a dedifferentiated phenotype. Solitary fibrous tumor dedifferentiation is associated with the loss of chimeric oncoprotein expression, genomic instability, and cell decommitment and reprogramming. The assessment of dedifferentiated solitary fibrous tumors is based on the presence of the fusion transcripts and, in principle, negative STAT6 immunohistochemistry should not rule out a diagnosis of solitary fibrous tumor. Modern Pathology (2015Pathology ( ) 28, 1074Pathology ( -1083 doi:10.1038/modpathol.2015 published online 29 May 2015 Solitary fibrous tumors are rare mesenchymal tumors (incidence o 1 per million) that were originally described on the pleurae but have subsequently been recognized at virtually all body sites. 1 The current classification includes usual, malignant and the recently described dedifferentiated variants. [1][2][3] The morphobiological features distinguishing the malignant and usual variants are hypercellularity, cell pleomorphism, necrosis and a mitotic index of 44/10 high-power fields. However,

show abstract

“…1-6) as having usual, 8 as having malignant (nos. [7][8][9][10][11][12][13][14], and 10 as having dedifferentiated solitary fibrous tumors (nos. [15][16][17][18][19][20][21][22][23][24].…”

Section: Patients and Primary Tumorsmentioning

confidence: 99%

Section: Reverse-transcription Polymerase Chain Reaction and Sequencingmentioning

confidence: 99%

Section: Immunohistochemistrymentioning

confidence: 99%

“…15, 16, 17, 21b, 22a and b, 23a and b, and 24a and b) with suitable genomic DNA; exons 5-8 were amplified and sequenced as previously described. 14 …”

Section: Tp53 Mutational Analysismentioning

confidence: 99%

See 2 more Smart Citations

Solitary fibrous tumors: loss of chimeric protein expression and genomic instability mark dedifferentiation

et al. 2015

Self Cite

View full text Add to dashboard Cite

show abstract

“…1 HPV-positive cancers of the head and neck arise mainly in the oropharynx and define a subgroup of radioand chemosensitive tumors with distinct clinical, pathological and molecular features and improved prognosis with respect to their HPV-negative counterparts. [2][3][4][5] The majority of HPVrelated oropharyngeal squamous cell carcinomas (OSCC) express wild-type TP53, 6,7 which might be involved in the improved response of tumors to treatment. Despite thorough analysis of gene expression profiles of HPV-positive OSCC by several groups, [8][9][10][11] no novel prognostic or predictive biomarker has been identified, and the molecular mechanisms that underlie improved prognosis of HPV-related OSCC are poorly understood.…”

mentioning

confidence: 99%

CD8‐alpha T‐cell infiltration in human papillomavirus‐related oropharyngeal carcinoma correlates with improved patient prognosis

Jung

Guihard²,

Krugell³

et al. 2012

Intl Journal of Cancer

View full text Add to dashboard Cite

Patients with human papillomavirus (HPV)-related oropharyngeal tumors display improved prognosis. The biological basis of this tumor phenotype is poorly understood. We investigated whether increased lymphocyte infiltrate in HPV-positive oropharyngeal squamous cell carcinomas could account for better prognosis. We previously identified, in an Affymetrix GeneChip analysis of 83 HPV-unrelated and 11 HPV-related squamous cell carcinoma of the oropharynx, several candidate genes, including CD8a and CD3f. Their expression was validated in this study by qRT-PCR on an independent clinical series of 144 oropharyngeal tumors. Immunohistochemical staining of tumor specimens was performed to evaluate infiltration of tumor stroma by CD81 and CD41 lymphocytes. The prognostic value of CD8a and CD3f expression levels was measured by Kaplan-Meier and Cox regression model analyses. Immune response-related signaling pathways were found to be deregulated in HPV-positive oropharyngeal tumors. Expression of CD8a, CD3f, granzyme K, CD28 and integrin aL RNAs was upregulated in HPV-positive lesions when compared with HPV-unrelated tumors (p < 0.05). Stroma of HPV-positive tumors was frequently and strongly infiltrated by CD8a-and CD3f-positive T cells. CD8a RNA expression correlated with both improved global (Kaplan-Meier; p 5 0.005; Cox regression: p 5 0.003) and disease-free (Cox regression: p 5 0.04) survival. CD3f RNA expression correlated with improved overall survival (Cox regression: p 5 0.024). These results suggest that an increased cytotoxic T-cell-based antitumor immune response is involved in improved prognosis of patients with HPV-positive tumors.The presence of human papillomaviruses (HPVs; mainly HPV type 16) correlates with the onset and development of about 25% of head and neck squamous cell carcinomas (HNSCC). 1 HPV-positive cancers of the head and neck arise mainly in the oropharynx and define a subgroup of radioand chemosensitive tumors with distinct clinical, pathological and molecular features and improved prognosis with respect to their HPV-negative counterparts. [2][3][4][5] The majority of HPVrelated oropharyngeal squamous cell carcinomas (OSCC) express wild-type TP53, 6,7 which might be involved in the improved response of tumors to treatment. Despite thorough analysis of gene expression profiles of HPV-positive OSCC by several groups, [8][9][10][11] no novel prognostic or predictive biomarker has been identified, and the molecular mechanisms that underlie improved prognosis of HPV-related OSCC are poorly understood.The immune response has an important impact in many HPV-associated tumors and can have either favorable or unfavorable consequences. 12 The importance of the immune response in HPV-related OSCC is less well established. An increased T-cell response against HPV E7 epitopes has been detected in the blood of patients with HPV-positive HNSCC. 13-15 A more recent study has shown that T cells that proliferate and synthesize inflammatory cytokines upon HPV16 E6 and E7 oncoprotein recognition can be isolate...

show abstract

Tradition, Teamwork, and Tailored Treatment<subtitle>Surgical Oncology in the Genomic Era</subtitle>

Wolf

2009

Arch Otolaryngol Head Neck Surg

View full text Add to dashboard Cite

High-Risk Human Papillomavirus Affects Prognosis in Patients With Surgically Treated Oropharyngeal Squamous Cell Carcinoma

Cited by 598 publications

References 44 publications

Solitary fibrous tumors: loss of chimeric protein expression and genomic instability mark dedifferentiation

Solitary fibrous tumors: loss of chimeric protein expression and genomic instability mark dedifferentiation

CD8‐alpha T‐cell infiltration in human papillomavirus‐related oropharyngeal carcinoma correlates with improved patient prognosis

Tradition, Teamwork, and Tailored Treatment<subtitle>Surgical Oncology in the Genomic Era</subtitle>

Contact Info

Product

Resources

About