High‐yield membrane protein expression from <i>E. coli</i> using an engineered outer membrane protein F fusion

Su, Pin-Chuan; Si, William; Baker, Deidre L.; Berger, Bryan W.

doi:10.1002/pro.2224

Cited by 11 publications

(6 citation statements)

References 39 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…A wide variety of expression strategies for membrane proteins are available 22,23 . We typically express membrane proteins with histidine affinity tags, which when overexpressed at 37 °C are typically observed in both membranes and inclusion bodies 24–30 .…”

Section: Experimental Designmentioning

confidence: 99%

Lipid bilayer preparations of membrane proteins for oriented and magic-angle spinning solid-state NMR samples

2013

View full text Add to dashboard Cite

Solid-state NMR spectroscopy has been used successfully for characterizing the structure and dynamics of membrane proteins as well as their interactions with other proteins in lipid bilayers. such an environment is often necessary for achieving native-like structures. sample preparation is the key to this success. Here we present a detailed description of a robust protocol that results in high-quality membrane protein samples for both magic-angle spinning and oriented-sample solid-state NMR. the procedure is demonstrated using two proteins: CrgA (two transmembrane helices) and rv1861 (three transmembrane helices), both from Mycobacterium tuberculosis. the success of this procedure relies on two points. First, for samples for both types of NMR experiment, the reconstitution of the protein from a detergent environment to an environment in which it is incorporated into liposomes results in ‘complete’ removal of detergent. second, for the oriented samples, proper dehydration followed by rehydration of the proteoliposomes is essential. By using this protocol, proteoliposome samples for magic-angle spinning NMR and uniformly aligned samples (orientational mosaicity of <1°) for oriented-sample NMR can be obtained within 10 d.

show abstract

Section: Experimental Designmentioning

confidence: 99%

Lipid bilayer preparations of membrane proteins for oriented and magic-angle spinning solid-state NMR samples

2013

View full text Add to dashboard Cite

show abstract

“…An increase in correctly inserted membrane proteins was established by decreasing the amount of TF while at the same time elevating the SRP level. Some N-terminal fusion proteins are known to improve membrane protein production, putatively through promoting SRP-dependent targeting and/or membrane insertion of the overexpressed protein [43,60–62]. We show here that these adaptations could also be responsible for guiding ribosomes carrying alien mRNA to the membrane: Interchanging the N-terminal domains of PS1Δ9 and BcaP resulted in a reversal in mRNA localization patterns and improved production of PS1Δ9.…”

Section: Discussionmentioning

confidence: 73%

On the Spatial Organization of mRNA, Plasmids, and Ribosomes in a Bacterial Host Overexpressing Membrane Proteins

et al. 2016

View full text Add to dashboard Cite

By using fluorescence imaging, we provide a time-resolved single-cell view on coupled defects in transcription, translation, and growth during expression of heterologous membrane proteins in Lactococcus lactis. Transcripts encoding poorly produced membrane proteins accumulate in mRNA-dense bodies at the cell poles, whereas transcripts of a well-expressed homologous membrane protein show membrane-proximal localization in a translation-dependent fashion. The presence of the aberrant polar mRNA foci correlates with cessation of cell division, which is restored once these bodies are cleared. In addition, activation of the heat-shock response and a loss of nucleoid-occluded ribosomes are observed. We show that the presence of a native-like N-terminal domain is key to SRP-dependent membrane localization and successful production of membrane proteins. The work presented gives new insights and detailed understanding of aberrant membrane protein biogenesis, which can be used for strategies to optimize membrane protein production.

show abstract

“…Due to poor, insoluble, and heterologous expression, Hyp730 was subcloned into an E . coli ‐based membrane protein overexpression system that carries an engineered bacterial outer membrane protein F (pOmpF) (Su et al, 2013). PCR amplification of Hyp730 with the forward and reverse primers 5′‐caagcatatgATGgccagccccgaggcc‐3′ and 5′‐gattggatcctcagtctccggggtgggc‐3′ were used to generate a NheI/BamHI cleavable fragment, which attaches to the pOmpF tag, and a linker sequence [GGGGGLVPRGSGTTSASGS] containing a polyglycine linker and thrombin cleavage site.…”

Section: Methodsmentioning

confidence: 99%

“…Due to poor, insoluble, and heterologous expression, Hyp730 was subcloned into an E. coli-based membrane protein overexpression system that carries an engineered bacterial outer membrane protein F (pOmpF) (Su et al, 2013). PCR amplification of Hyp730 with the forward and reverse primers 5′-caagcatatgATGgccagccccgaggcc-3′…”

Section: Cloning Of Hyp730mentioning

confidence: 99%

Functional and structural characterization of Hyp730, a highly conserved and dormancy‐specific hypothetical membrane protein

et al. 2021

View full text Add to dashboard Cite

Membrane proteins represent major drug targets, and the ability to determine their functions, structures, and conformational changes will significantly advance mechanistic approaches to both biotechnology and bioremediation, as well as the fight against pathogenic bacteria. A pertinent example is Mycobacterium tuberculosis (H37Rv), which contains ~4000 protein‐coding genes, with almost a thousand having been categorized as ‘membrane protein’, and a few of which (~1%) have been functionally characterized and structurally modeled. However, the functions and structures of most membrane proteins that are sparsely, or only transiently, expressed, but essential in small phenotypic subpopulations or under stress conditions such as persistence or dormancy, remain unknown. Our deep quantitative proteomics profiles revealed that the hypothetical membrane protein 730 (Hyp730) WP_010079730 (protein ID Mlut_RS11895) from M. luteus is upregulated in dormancy despite a ~5‐fold reduction in overall protein diversity. Its H37Rv paralog, Rv1234, showed a similar proteomic signature, but the function of Hyp730‐like proteins has never been characterized. Here, we present an extensive proteomic and transcriptomic analysis of Hyp730 and have also characterized its in vitro recombinant expression, purification, refolding, and essentiality as well as its tertiary fold. Our biophysical studies, circular dichroism, and tryptophan fluorescence are in immediate agreement with in‐depth in silico 3D‐structure prediction, suggesting that Hyp730 is a double‐pass membrane‐spanning protein. Ablation of Hyp730‐expression did not alter M. luteus growth, indicating that Hyp730 is not essential. Structural homology comparisons showed that Hyp730 is highly conserved and non‐redundant in G+C rich Actinobacteria and might be involved, under stress conditions, in an energy‐saving role in respiration during dormancy.

show abstract

High‐yield membrane protein expression from E. coli using an engineered outer membrane protein F fusion

Cited by 11 publications

References 39 publications

Lipid bilayer preparations of membrane proteins for oriented and magic-angle spinning solid-state NMR samples

Lipid bilayer preparations of membrane proteins for oriented and magic-angle spinning solid-state NMR samples

On the Spatial Organization of mRNA, Plasmids, and Ribosomes in a Bacterial Host Overexpressing Membrane Proteins

Functional and structural characterization of Hyp730, a highly conserved and dormancy‐specific hypothetical membrane protein

Contact Info

Product

Resources

About