Highly potent, non-basic 5-HT6 ligands. Site mutagenesis evidence for a second binding mode at 5-HT6 for antagonism

Harris, R. N. Iii; Stabler, Russel S.; Repke, David B.; Kress, James M.; Walker, K.; Martin, Renée S.; Brothers, Julie M.; Ilnicka, Mariola; Lee, Simon W.; Mirzadegan, Taraneh

doi:10.1016/j.bmcl.2010.03.110

Cited by 37 publications

(26 citation statements)

References 34 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…Embryos from time-mated pregnant E14.5 C57-BL6 mice were electroporated in the lateral VZ of the dorsal pallium as described previously ( Riccio et al, 2011 ). The following plasmids were used at concentrations of 0.75 µg/ml or 1 µg/ml and were co-electroporated in equal ratios in control and experimental conditions: 5-HT6R-shRNA1 (TRCN0000027429 mature sense: GCGCAACACGTCTAACTTCTT, Thermoscientific), 5-HT6R2-shRNA (TRCN0000027469 mature sense: GCCATGCTGAACGCGCTGTAT, Thermoscientific) and scrambled shRNA (mature sense: CCTAAGGTTAAGTCGCCCTCG, Addgene), which were under the regulation of the human U6 promoter; pUB6-tdTomato, pUB6-Cdk5, pUB6-p35, pUB6 human (h)5-HT6R containing three silent mutations in the 5-HT6R-shRNA1 binding region [(h)5-HT6R-rescue], pUB6 (h)5-HT6R-rescue backbone containing three mutations (F69L, T70I, D72A) at conserved transmembrane domain II residues (which abolished constitutive and serotonin-induced cAMP signalling through Gs) [(h)5-HT6R-Gs-dead] ( Harris et al, 2010 ) and pUB6 (h)5-HT6R-rescue backbone containing a D106A mutation (which abolished serotonin-induced cAMP signalling) [(h)5-HT6R-D106A] ( Zhang et al, 2006 ), which were under the regulation of the ubiquitin promoter (pUB6). The pUB6 (h)5-HT6R-rescue backbone contained an N-terminal HA tag.…”

Section: Methodsmentioning

confidence: 99%

The serotonin 6 receptor controls neuronal migration during corticogenesis via a ligand-independent Cdk5-dependent mechanism

et al. 2014

View full text Add to dashboard Cite

The formation of a laminar structure such as the mammalian neocortex relies on the coordinated migration of different subtypes of excitatory pyramidal neurons in specific layers. Cyclin-dependent kinase 5 (Cdk5) is a master regulator of pyramidal neuron migration. Recently, we have shown that Cdk5 binds to the serotonin 6 receptor (5-HT6R), a G protein-coupled receptor (GPCR). Here, we investigated the role of 5-HT6R in the positioning and migration of pyramidal neurons during mouse corticogenesis. We report that constitutive expression of 5-HT6R controls pyramidal neuron migration through an agonist-independent mechanism that requires Cdk5 activity. These data provide the first in vivo evidence of a role for constitutive activity at a GPCR in neocortical radial migration.

show abstract

Section: Methodsmentioning

confidence: 99%

The serotonin 6 receptor controls neuronal migration during corticogenesis via a ligand-independent Cdk5-dependent mechanism

et al. 2014

View full text Add to dashboard Cite

show abstract

“…Embryos from time-mated pregnant E14.5 C57-BL6 mice were electroporated in the lateral VZ of the dorsal pallium as described previously (Riccio et al, 2011). The following plasmids were used at concentrations of 0.75 µg/ml or 1 µg/ml and were co-electroporated in equal ratios in control and experimental conditions: 5-HT6R-shRNA1 (TRCN0000027429 mature sense: GCGCAACACGTCTAACTTCTT, Thermoscientific), 5-HT6R2-shRNA (TRCN0000027469 mature sense: GCCATGCTGAACGCGCTGTAT, Thermoscientific) and scrambled shRNA (mature sense: CCTAAGGTTAAGTCGCCCTCG, Addgene), which were under the regulation of the human U6 promoter; pUB6-tdTomato, pUB6-Cdk5, pUB6-p35, pUB6 human (h)5-HT6R containing three silent mutations in the 5-HT6R-shRNA1 binding region [(h)5-HT6R-rescue], pUB6 (h)5-HT6R-rescue backbone containing three mutations (F69L, T70I, D72A) at conserved transmembrane domain II residues (which abolished constitutive and serotonin-induced cAMP signalling through Gs) [(h)5-HT6R-Gs-dead] (Harris et al, 2010) and pUB6 (h)5-HT6R-rescue backbone containing a D106A mutation (which abolished serotonininduced cAMP signalling) [(h)5-HT6R-D106A] (Zhang et al, 2006), which were under the regulation of the ubiquitin promoter ( pUB6). The pUB6 (h) 5-HT6R-rescue backbone contained an N-terminal HA tag.…”

Section: In Utero Electroporation and Plasmidsmentioning

confidence: 99%

The serotonin 6 receptor controls neuronal migration during corticogenesis via a ligand-independent Cdk5-dependent mechanism

Jacobshagen¹,

Niquille²,

Chaumont‐Dubel³

et al. 2014

Journal of Cell Science

View full text Add to dashboard Cite

show abstract

“…Despite lacking the capability of forming a salt bridge (strong, charge assisted hydrogen bond) with Asp3.32 such chemical entities have been shown to bind to 5-HT 2A R 38 and later to 5-HT 6 and 5-HT 1B receptors with nanomolar and subnanomolar potencies 39, 40 . Interestingly, there have been no published examples of low-basicity ligands of the 5-HT 7 receptor 41 .…”

Section: Introductionmentioning

confidence: 99%

Low-basicity 5-HT7 Receptor Agonists Synthesized Using the van Leusen Multicomponent Protocol

Hogendorf

Kurczab

et al. 2017

Sci Rep

View full text Add to dashboard Cite

A series of 5-aryl-1-alkylimidazole derivatives was synthesized using the van Leusen multicomponent reaction. The chemotype is the first example of low-basicity scaffolds exhibiting high affinity for 5-HT 7 receptor together with agonist function. The chosen lead compounds 3-(1-ethyl-1H-imidazol-5-yl)-5-iodo-1H-indole (AGH-107, 1o, K i 5-HT7 = 6 nM, EC 50 = 19 nM, 176-fold selectivity over 5-HT 1A R) and 1e (5-methoxy analogue, K i 5-HT7 = 30 nM, EC 50 = 60 nM) exhibited high selectivity over related CNS targets, high metabolic stability and low toxicity in HEK-293 and HepG2 cell cultures. A rapid absorption to the blood, high blood-brain barrier permeation and a very high peak concentration in the brain (C max = 2723 ng/g) were found for 1o after i.p. (5 mg/kg) administration in mice. The compound was found active in novel object recognition test in mice, at 0.5, 1 and 5 mg/kg. Docking to 5-HT 7 R homology models indicated a plausible binding mode which explain the unusually high selectivity over the related CNS targets. Halogen bond formation between the most potent derivatives and the receptor is consistent with both the docking results and SAR. 5-Chlorine, bromine and iodine substitution resulted in a 13, 27 and 89-fold increase in binding affinities, respectively, and in enhanced 5-HT 1A R selectivity.Within the serotonergic system, 5-HT 7 , the last identified serotonin receptor, is one of the most valuable drug targets 1 . Discovered independently by three laboratories in 1993 2-4 , 5-HT 7 R was thought to function by being coupled to G s to stimulate intracellular production of cAMP, but it was later found to also be coupled to G 12 which is an alternative signal transduction pathway 5 . 5-HT 7 R is expressed in the central nervous system (thalamus, hypothalamus, hippocampus and cortex) as well as peripherally (pancreas, spleen, coronary artery, ileum and intestine) [3][4][5][6] . Experiments using animal models have shown that the receptor is involved in many physiological processes, i.e. the regulation of body temperature 7 , smooth muscle relaxation of cerebral arteries 8 , circadian rhythm, learning and memory 9-13 , as well as pathophysiological processes such as mood disorders, anxiety 14 , inflammatory processes in the CNS 15 , schizophrenia 16 and pain 17,18 . 5-HT 7 R antagonists have been proposed as potential drugs targeting depression 19,20 . There have been less conclusive reports on potential anxiolytic 21,22 , analgesic 17 and antipsychotic properties of the receptor ligands 23,24 . It was established that 5-HT 7 R blockade can induce promnesic effects indicating the possibility of developing atypical procognitive antidepressants 25 .There are several 5-HT 7 R agonists available to serve as molecular probes. These include small, low-weight molecules, e.g. AS-19 26 , RA-7 7 , 5-carboxyamidotryptamine (5-CT), 5-methoxytryptamine, 8-OH-DPAT 27 , and lysergic acid derivatives 28 and long-chain diphenylpiperazines (LP-12, LP-44, LP-211) developed by . None of these compounds qualify as perfect...

show abstract

Highly potent, non-basic 5-HT6 ligands. Site mutagenesis evidence for a second binding mode at 5-HT6 for antagonism

Cited by 37 publications

References 34 publications

The serotonin 6 receptor controls neuronal migration during corticogenesis via a ligand-independent Cdk5-dependent mechanism

The serotonin 6 receptor controls neuronal migration during corticogenesis via a ligand-independent Cdk5-dependent mechanism

The serotonin 6 receptor controls neuronal migration during corticogenesis via a ligand-independent Cdk5-dependent mechanism

Low-basicity 5-HT7 Receptor Agonists Synthesized Using the van Leusen Multicomponent Protocol

Contact Info

Product

Resources

About