Highly Sensitive <i>EGFRvIII</i> Detection in Circulating Extracellular Vesicle RNA of Glioma Patients

Batool, Syeda Maheen; Muralidharan, Koushik; Hsia, Tiffaney; Falotico, Sarah; Gamblin, Austin S.; Rosenfeld, Yulia B.; Khanna, Sirena K.; Balaj, Leonora; Carter, Bob S.

doi:10.1158/1078-0432.ccr-22-0444

Cited by 24 publications

(9 citation statements)

References 38 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…It is important to note that EGFRvIII is one of the few tumor-specific antigens in GBM known to date and one that has been demonstrated to be safe as a CAR T cell target in clinical GBM studies 10,34 . Yet, antigen escape might pose a threat to all EGFRvIII-targeted treatments 65 , underscoring the need for careful patient stratification using reliable pre-therapeutic plasma 66 or tissue biopsy analysis to confirm the presence of this oncogenic mutation also in recurrent GBM. Importantly, recent studies using more sensitive methods of detection, suggest that even up to 70% of GBM patients express EGFRvIII 66 .…”

Section: Discussionmentioning

confidence: 99%

“…Yet, antigen escape might pose a threat to all EGFRvIII-targeted treatments 65 , underscoring the need for careful patient stratification using reliable pre-therapeutic plasma 66 or tissue biopsy analysis to confirm the presence of this oncogenic mutation also in recurrent GBM. Importantly, recent studies using more sensitive methods of detection, suggest that even up to 70% of GBM patients express EGFRvIII 66 .…”

Section: Discussionmentioning

confidence: 99%

See 1 more Smart Citation

Enhancing anti-EGFRvIII CAR T cell therapy against glioblastoma with a paracrine SIRPγ-derived CD47 blocker

Martins,

Tatari,

Kaymak

et al. 2023

Preprint

View full text Add to dashboard Cite

A major challenge for chimeric antigen receptor (CAR) T cell therapy against glioblastoma (GBM) is its immunosuppressive tumor microenvironment (TME), which is densely populated and supported by protumoral glioma-associated microglia and macrophages (GAMs). Targeting of CD47, a “don’t-eat-me” signal overexpressed by tumor cells, disrupts the CD47-SIRPα axis and induces GAM phagocytic function. However, antibody-mediated CD47 blockade monotherapy is associated with toxicity and low bioavailability in solid tumors. To overcome these limitations, we combined local CAR T cell therapy with paracrine GAM modulation for more effective elimination of GBM. To this end, we engineered a new CAR T cell against epidermal growth factor receptor variant III (EGFRvIII) that constitutively secretes a SIRPγ-related protein (SGRP) with high affinity to CD47. Anti-EGFRvIII-SGRP CAR T cells eliminated EGFRvIII+GBM in a dose-dependent mannerin vitroand eradicated orthotopically xenografted EGFRvIII-mosaic GBM by locoregional applicationin vivo.This resulted in significant tumor-free long-term survival, followed by partial tumor control upon tumor re-challenge. The combination of anti-CD47 antibodies with anti-EGFRvIII CAR T cells failed to achieve a similar therapeutic effect, underscoring the importance of sustained paracrine GAM modulation. Multidimensional brain immunofluorescence microscopy and in-depth spectral flow cytometry on GBM-xenografted brains showed that anti-EGFRvIII-SGRP CAR T cells accelerated GBM clearance, increased CD68+cell trafficking to tumor scar sites, and induced myeloid-mediated tumor cell uptake. Additionally, in a peripheral lymphoma mouse xenograft model, anti-CD19-SGRP CAR T cells had superior efficacy compared to conventional anti-CD19 CAR T cells. Validation on human GBM explants revealed that anti-EGFRvIII-SGRP CAR T cells had similar tumor-killing capacity to anti-EGFRvIII CAR monotherapy, but showed a slight improvement in maintenance of tumor-infiltrated CD14+myeloid cells. Thus, local anti-EGFRvIII-SGRP CAR T cell therapy combines the potent antitumor effect of engineered T cells with the modulation of the surrounding innate immune TME, resulting in the additive elimination of bystander EGFRvIII-tumor cells in a manner that overcomes major mechanisms of CAR T cell therapy resistance, including tumor innate immune suppression and antigen escape.

show abstract

Section: Discussionmentioning

confidence: 99%

Section: Discussionmentioning

confidence: 99%

Enhancing anti-EGFRvIII CAR T cell therapy against glioblastoma with a paracrine SIRPγ-derived CD47 blocker

Martins,

Tatari,

Kaymak

et al. 2023

Preprint

View full text Add to dashboard Cite

show abstract

“…One of the main obstacles in detecting glioma from plasma EVs is the isolation and quantification of tumor‐derived EVs from a heterogenous background. While techniques have sought to amplify detection through enrichment and modification of downstream analytes, [ 34 ] it is also important to establish the baseline capacities of the explored processing methods. We have found that the recovery of tumor‐derived EVs from a healthy plasma EV background, as defined by EGFRvIII capture in IMEX and EGFRvIII RNA quantification in ddPCR, follows the patterns of analyte isolation identified in in vitro study.…”

Section: Discussionmentioning

confidence: 99%

Rigorous Comparison of Extracellular Vesicle Processing to Enhance Downstream Analysis for Glioblastoma Characterization

Hsia,

You,

Politis

et al. 2023

Advanced Biology

Self Cite

View full text Add to dashboard Cite

Extracellular vesicles (EVs) are highly sought after as a source of biomarkers for disease detection and monitoring. Tumor EV isolation, processing, and evaluation from biofluids is convoluted by EV heterogeneity and biological contaminants and is limited by technical processing efficacy. This study rigorously compares common bulk EV isolation workflows (size exclusion chromatography, SEC; membrane affinity, MA) alongside downstream RNA extraction protocols to investigate molecular analyte recovery. EV integrity and recovery is evaluated using a variety of technologies to quantify total intact EVs, total and surface proteins, and RNA purity and recovery. A comprehensive evaluation of each analyte is performed, with a specific emphasis on maintaining user (n = 2), biological (n = 3), and technical replicates (n≥3) under in vitro conditions. Subsequent study of tumor EV spike‐in into healthy donor plasma samples is performed to further validate biofluid‐derived EV purity and isolation for clinical application. Results show that EV surface integrity is considerably preserved in eluates from SEC‐derived EVs, but RNA recovery and purity, as well as bulk protein isolation, is significantly improved in MA‐isolated EVs. This study concludes that EV isolation and RNA extraction pipelines govern recovered analyte integrity, necessitating careful selection of processing modality to enhance recovery of the analyte of interest.

show abstract

“…Using the 2 –ΔΔCt technique and β -actin as the reference gene, the mRNA expression of each gene was evaluated. The primer used for GCSF (Forward Primer GTGCCACCTACAAGCTGTGC and Reverse Primer AAAGGCCGCTATGGAGTTGG) and GCSFR (Forward Primer AAGAGCCCCCTTACCCACTACACCATCTT and Reverse Primer TGCTGTGAGCTGGGTCTGGGACACTT), STAT3 (Forward Primer CATATGCGGCCAGCAAAGAA and Reverse Primer ATACCTGCTCTGAAGAAACT) and for β –actin (Forward Primer CATGTACGTTGCTATCCAGGC and Reverse Primer CTCCTTAATGTCACGCACGAT) 18 , 19 .…”

Section: Methodsmentioning

confidence: 99%

Potential diagnostic and drug target markers in glioblastoma

Ahsan,

Asghar,

Malik

2024

Sci Rep

View full text Add to dashboard Cite

Glioblastoma multiforme (GBM) IDH-wildtype is the most prevalent brain malignancy in adults. However, molecular mechanisms, which leads to GBM have not been completely elucidated. Granulocyte colony-stimulating factor (GCSF), Granulocyte colony-stimulating factor receptor GCSFR, and Signal transducers and activators of transcription 3 (STAT3) have been involved in the occurrence and development of various cancers, but their role in GBM is little known. Herein, we have investigated the gene and protein expression of GCSF, GCSFR, and STAT3 in 21 tissue biopsy samples and also in tumor associated normal tissue (TANT) samples derived from glioblastoma patients, which revealed significantly differential expression of these genes. To validate our findings, we performed a comprehensive integrated analysis of transcriptomic and proteomic profiling of respective genes by retrieving GBM RNA-sequence data from Genome Atlas Databases. GO and KEGG analysis revealed enrichment in disease-related pathways, such as JAK/STAT pathway activation, which were associated with GBM progression. We further performed computational docking analysis of potential drug candidate Nisin against GCSF, and the results were validated in vitro through cytotoxic activity assay using a human glioblastoma cell line SF-767 in a dose-dependent manner. Our comprehensive analysis reveals that GCSF augments glioma progression, and its blockade with anticancer bacteriocin peptide Nisin can potentially inhibit the growth and metastasis of GBM.

show abstract

Highly Sensitive EGFRvIII Detection in Circulating Extracellular Vesicle RNA of Glioma Patients

Cited by 24 publications

References 38 publications

Enhancing anti-EGFRvIII CAR T cell therapy against glioblastoma with a paracrine SIRPγ-derived CD47 blocker

Enhancing anti-EGFRvIII CAR T cell therapy against glioblastoma with a paracrine SIRPγ-derived CD47 blocker

Rigorous Comparison of Extracellular Vesicle Processing to Enhance Downstream Analysis for Glioblastoma Characterization

Potential diagnostic and drug target markers in glioblastoma

Contact Info

Product

Resources

About