Histone Deacetylase 3, a Class I Histone Deacetylase, Suppresses MAPK11-Mediated Activating Transcription Factor-2 Activation and Represses TNF Gene Expression

Abstract

During inflammatory events, the induction of immediate-early genes, such as TNF-α, is regulated by signaling cascades including the JAK/STAT, NF-κB, and the p38 MAPK pathways, which result in phosphorylation-dependent activation of transcription factors. We observed the direct interaction of histone deacetylase (HDAC) 3, a class I histone deacetylase, with MAPK11 (p38 β isoform) by West-Western-based screening analysis, pull-down assay, and two-hybrid system analysis. Results further indicated that HDAC3 decreases the MAPK11 phosphorylation state and inhibits the activity of the MAPK11-dependent transcription factor, activating transcription factor-2 (ATF-2). LPS-mediated activation of ATF-2 was inhibited by HDAC3 in a time- and dose-dependent manner. Inhibition of HDAC3 expression by RNA interference resulted in increased ATF-2 activation in response to LPS stimulation. In agreement with decreased ATF-2 transcriptional activity by HDAC3, HDAC3-repressed TNF gene expression, and TNF protein production observed in response to LPS stimulation. Therefore, our results indicate that HDAC3 interacts directly and selectively with MAPK11, represses ATF-2 transcriptional activity, and acts as a regulator of TNF gene expression in LPS-stimulated cells, especially in mononuclear phagocytes.

Synthetic Vpr Protein Activates Activator Protein-1, c-Jun N-terminal Kinase, and NF-κB and Stimulates HIV-1 Transcription in Promonocytic Cells and Primary Macrophages

“…Both synthetic Vpr and TNF activate AP-1, JNK, NF-B (Figs. 1-3), and ATF-2 (data not shown), suggesting that they modulate the cellular machinery in a similar way and, therefore, could have the same effect on HIV replication in mononuclear phagocytes (71,80). We observed that synthetic Vpr, like TNF treatment, stimulates HIV-1 replication in the chronically infected promonocytic cell line U1 (70).…”

“…As a control, an anti-Vpr antibody was used (10 g/ml). activated protein kinase pathway, which is also involved in NF-B activation (54,67,71,74). Because typical HIV targets, such as monocytes or T cells, would be quiescent and unlikely to contain sufficient amounts of active transcription factor to support initial HIV replication (56), Vpr, in addition to transporting the preintegration virus RNA complex, also may serve to activate transcription factors such as AP-1 and NF-B and allow for an initial burst of HIV transcription (67).…”

“…FicollHypaque (Eurobio)-isolated human peripheral blood mononuclear cells were incubated for 2 h on plastic. Adherent differentiated M⌽ (Ͼ94% CD14ϩ by flow cytometric analysis) were cultured in RPMI medium supplemented with 10% (v/v) pooled human serum (kindly provided by the Etablissement Français du Sang Bourgogne Franche-Comté, France) as previously reported (71).…”

“…The cells were incubated for 0, 24, 48, and 72 h in a buffer containing 100 mM KCl, 20 mM Tris (pH 8.4), 500 g of proteinase K/ml, and 0.2% (v/v) Nonidet P-40, as previously described (73). Real-time PCR was performed on cell lysates according to the manufacturer's instructions using the ABI Prism 7000 PCR system (Applied Biosystems, Foster City, CA), as previously described (71). The PCR primer sequences for LTR and human ␤-globin gene (DNA control) were as follows: HIV-1 LTR primers, CACACAAGGCTACTTC-CCTGA (U3 (sense)) and GATCTCTAGTTACCAGAGTCAC (U5 (antisense)); human ␤-globin primers (5Ј-GAAGAGCCAAGGACAG-GTAC-3Ј (sense); 5Ј-CAACTTCA TCCACGTTCACC-3Ј (antisense)) (71,73).…”

HDAC-mediated control of ERK- and PI3K-dependent TGF-β-induced extracellular matrix-regulating genes

“…This suggested for the first time that HDAC3 is required for efficient gene expression via its role in activating signalling pathways. Previously HDAC3 has only been recognised for its role in suppressing signalling pathways such as p38, NF-κB and JAK/STAT (Chen et al, 2001;Mahlknecht et al, 2004;Togi et al, 2009). We over-expressed active and deacetylase-inactive forms of HDAC3 in our C3H10T1/2 cells but found no significant effect on the induction of a proximal promoter Timp-1 construct (Supp.…”