Histone Deacetylase Inhibitors Target the Leukemic Microenvironment by Enhancing a Nherf1-Protein Phosphatase 1α-TAZ Signaling Pathway in Osteoblasts

Abstract

Disrupting the protective signals provided by the bone marrow microenvironment will be critical for more effective combination drug therapies for acute myeloid leukemia (AML). Cells of the osteoblast lineage that reside in the endosteal niche have been implicated in promoting survival of AML cells. Here, we investigated how to prevent this protective interaction. We previously showed that SDF-1, a chemokine abundant in the bone marrow, induces apoptosis of AML cells, unless the leukemic cells receive protective signals provided by differentiating osteoblasts (8, 10). We now identify a novel signaling pathway in differentiating osteoblasts that can be manipulated to disrupt the osteoblast-mediated protection of AML cells. Treating differentiating osteoblasts with histone deacetylase inhibitors (HDACi) abrogated their ability to protect co-cultured AML cells from SDF-1-induced apoptosis. HDACi prominently upregulated expression of the Nherf1 scaffold protein, which played a major role in preventing osteoblast-mediated protection of AML cells. Protein phosphatase-1␣ (PP1␣) was identified as a novel Nherf1 interacting protein that acts as the downstream mediator of this response by promoting nuclear localization of the TAZ transcriptional modulator. Moreover, independent activation of either PP1␣ or TAZ was sufficient to prevent osteoblast-mediated protection of AML cells even in the absence of HDACi. Together, these results indicate that HDACi target the AML microenvironment by enhancing activation of the Nherf1-PP1␣-TAZ pathway in osteoblasts. Selective drug targeting of this osteoblast signaling pathway may improve treatments of AML by rendering leukemic cells in the bone marrow more susceptible to apoptosis.For decades, research into drug treatments for acute myeloid leukemia (AML) 2 has focused on directly targeting AML cells for destruction. Even though complete remission rates have improved, relapse remains a problem in the majority of patients with this disease. The bone marrow microenvironment has gained attention as a protective environment that promotes survival of AML stem cells, despite the killing of the majority of AML cells by standard chemotherapeutics (1-5). The endosteum, the tissue between the bone marrow and ossified surface, has been particularly implicated as a protective niche because AML stem cells are localized to this region following chemotherapeutics (6, 7). Within the endosteal niche, cells of the osteoblast (bone-generating) lineage have been identified as critical mediators of AML cell survival in the bone marrow (4, 8). Transgenic mice expressing activated ␤-catenin specifically in osteoblasts develop myeloid malignancy, consistent with the idea that osteoblasts promote this disease (9). Unfortunately, the molecular mechanisms responsible for osteoblast-mediated protection of AML cells are incompletely understood. This lack of knowledge prevents effective therapeutic manipulation of the bone marrow microenvironment as a way to enhance targeting of AML cells within the bone marrow. We...

Assessment of different 3D culture systems to study tumor phenotype and chemosensitivity in pancreatic ductal adenocarcinoma

“…First of all, we found that the hypoxia marker, HIF-1α, which in human PDAC samples correlates with tumor size, aggressiveness and poor prognosis (26), exhibited the lowest protein levels in the 2D system and the highest expression in both Matrigel cultures exposed to EGF and in the organotypic cultures even in the absence of EGF. This expression pattern, which reflects the desmoplastic, hypovascularised and highly hypoxic nature of PDAC only in the organotypic model, was shared by another tumor hypoxia microenvironment-associated protein (27)(28)(29)(30), the scaffolding protein NHERF1. Importantly, NHERF1 expression is also increased in several human cancers including PDAC (10) and it can be phosphorylated by the protein kinase A (PKA), via the PKA-anchoring activity of ezrin (31).…”

Parathyroid hormone initiates dynamic NHERF1 phosphorylation cycling and conformational changes that regulate NPT2A-dependent phosphate transport

“…4C). Prior work first identified NHERF1 binding to PP1␣ but did not disclose a binding site (52). PP1 lacks a C-terminal PDZ sequence, suggesting that it did not bind NHERF1 through a canonical PDZ-ligand recognition motif.…”

“…We first directed our attention at identifying the phosphatase responsible for the rapid Ser 290 dephosphorylation. Our interest centered on PP1␣ because it was shown to bind NHERF1 (52) and was found here to be among the most frequent interacting NHERF1 partners (Table S1). Mass spectrometry analysis of pulldown samples revealed 10 unique PP1␣ peptides with greater than 45% sequence coverage (Table S2).…”

TCR-CXCR4 signaling stabilizes cytokine mRNA transcripts via a PREX1-Rac1 pathway: implications for CTCL

“…For NFAT localization, subcellular fractionation was performed as described. 35 The 39 untranslated region (UTR) luciferase reporter vector was generated by cloning the complete IL-2 39UTR into pmirGLO (Promega) using the following primers: 59GGCGCCGCTAGCTAATTAAGTGCTTCCCAC39 and 59GCCCGCGTC GACTTTTTTTTATATTTATCAAATTTATTAAATAGTTTTACTAACC39.…”