Histopathological, immunohistochemical, and molecular studies for determination of wound age and vitality in rats

Abstract

In forensic medicine, it is vital to verify with the best attainable accuracy once injuries occurred during vital or post‐mortem conditions. An immunohistochemical study was carried out to examine the time‐dependent expression of macrophage‐specific gene CD68 (cluster of differentiation 68), alpha‐smooth muscle actin (α‐SMA), and vascular endothelial growth factor (VEGF) in different skin wound timings (0, 1, 3, 5, 7, and 14 days) in rats. Histopathological studies were performed to assess the wound age and vitality. Eighteen male albino Wister rats (weighing 170‐200 g) were used for wound induction. Rats (n = 3) were euthanised at 0, 1, 3, 5, 7, and 14 days from the starting point of wound induction. Histopathological examination showed that the epidermal re‐epithelialisation was completed 14 days after skin incision. The inflammatory phase was recorded during the first 3 days of healing and reached the maximum levels at 5 days, then declined after 7 days, and completely removed at 14 days. The beginning of the proliferative phase was dated to day 3 and the peak at days 5 and 7. The initiation of the granulation tissue formation and remodelling phase of the healing process was observed 5 days after wounding. By immunohistochemical staining, negative VEGF gene expressions at early stages (0‐3 days) were observed, as well as neither CD68+ macrophages nor α‐SMA+ myofibroblast cells were detected. By increasing the wound ages (5‐7 days), granulation tissue and angiogenesis were observed, with the migration of macrophages and fibroblast, which expressed VEGF, CD68, and α‐SMA positive reaction. Time‐dependent expression of the above markers suggested that they would be useful indicators for the determination of wound age. Both VEGF and transforming growth factor‐beta 1 (TGFb1) mRNA levels were determined in different skin wound ages. The transcription of TGFb1 and VEGF increased shortly after wounding, until post‐wounding day 7. It then declined constantly, reaching minimal values on day 14.

Formulation and characterization of propolis and tea tree oil nanoemulsion loaded with clindamycin hydrochloride for wound healing: In-vitro and in-vivo wound healing assessment

“…Fibroblasts produce the continuous synthesis of collagen for numerous weeks during wound repairing ( Wang et al, 2017 ). The collagen formation starts at 3 to 6 days, and density increases until 14 days ( Khalaf et al, 2019 ). Excessive collagen tissue deposition is shared in ECM reconstruction with the additional support of skin growth ( Hoveizi et al, 2014 ).…”

State-of-the-Art on Wound Vitality Evaluation: A Systematic Review

“…It has been mainly used to highlight the presence of a healing and inflammatory response, which should be absent in post-mortem lesions. Nowadays, immunohistochemistry could be considered the "gold standard" in distinguishing between ante-and post-mortem lesions [113]. It is a morphological technique and could show the different distribution of the molecules of interest in the harmed tissue alongside their quantification.…”

“…Khalaf et al 2019 [113] Original research Animal Skin α-SMA and VEGF negative to mild expression at 0, 1, and 3 days after wounding. CD68 + macrophages from day 3 at the wound surface, peaking at day 7, and declining by day 14. α-SMA was still strongly expressed by day 14.…”

The effect of different concentrations of gold nanoparticles on growth performance, toxicopathological and immunological parameters of broiler chickens

“…The primer set used for Nrf-2 are Forward primer: ACGCTTTCTTCAGGGGTAGC; Reverse primer: GTTCGGTGCA-GAAGAGGTGA and those of the IL-6 were Forward primer: CTGCAGGACGAGATGTGCAA; Reverse primer: AGGTCTGAAAGGCGAACAGG. Real-time PCR was done using a Real-Time PCR System (Applied Biosystems, U.S.A.) which was run for 40 cycles of denaturation at 95 • C for 45 s, annealing at 59 • C for both genes for 45 s and extension at 72 • C for 45 s. The sizes of all amplicon (170bp for Nrf-2 and 175bp for IL-6) were confirmed by 2% agarose gel electrophoresis stained with SYBR Safe DNA gel stain (Invitrogen) [38].The β-actin gene was amplified in the same reaction to serve as the internal control [39]. Each assay was repeated three times, and the values were used to calculate the gene/ β-actin ratio, with a value of 1.0 used as the control (calibrator).…”