HIV/AIDS in Central Africa: Pathogenesis, Immunological and Medical Issues

Abstract

The estimated worldwide prevalence of human immunodeficiency virus (HIV) infections topped 52.5 million in June 2003, a mere 20 years after the aetiological agent was shown to be a sexually transmissible virus with a predilection for CD4+ T lymphocytes. More than 22 million people have died of the acquired immunodeficiency syndrome (AIDS) and the condition has in one generation become the most devastating and persistent epidemics in recorded history. More than two thirds of the world total of HIV-infected people live in Sub-Saharan Africa. In Central and Southern Africa at least 20% of the adult population is infected. As these adults die, they leave increasing numbers of orphans. Life expectancy at birth declined by 10 years per decade since the late 1980s to 50 years in the late 1990s, and in Botswana it is estimated to be as low as 33 years by 2010. The epidemic is increasing unabated and prospects for a curative or protective vaccine remain remote. The impact on HIV in Africa has been so profound that it influences political, economic, agriculture/food security, social, education, defence, science and health considerations. The medical and in particular immunology communities in Central Africa have the invidious challenge of on the one hand diagnosing the condition, monitoring its impact and contributing to treatment and management efforts. The science and clinical practice of immunology is challenged to find answers to the epidemic, perhaps including a vaccine. In this review we address the peculiarities of the HIV epidemic in Africa, its epidemiology and immunopathogenesis. We address the effect of the epidemic on individual patients, in their homes, workplaces and the knock-on effects on families and friends of the infected. Respective specialists discuss special groups (women, children) that are predominantly seen in Africa. We also discuss the impact of the epidemic on the clinical practice of medicine in general and challenges faced in the introduction of antiretroviral medicines. We also discuss options available for the diagnosis, treatment and monitoring of HIV-infected patients in this region.

Induction of Murine Mucosal CCR5-Reactive Antibodies as an Anti-Human Immunodeficiency Virus Strategy

“…Interestingly, the use of a recombinant protein, such as FHV-I2, even at a 20-fold-lower molar concentration, yielded higher antibody levels in mice than the synthetic cyclic CCR5 89-102 peptide. The FHV Epitope Presentation System (7,11,33) provided a good probability that, in at least one of the FHV loop positions (Fig. 1), the foreign epitope would be presented as an immunogen able to elicit antibodies reactive to the native epitope.…”

“…1 shows the numbers of the original amino acid residues, which are replaced by the epitope of choice). Each of the corresponding DNA sequences has been deleted and replaced with a Bsu36I site, which allows the directional insertion of an epitope-coding oligonucleotide (32,33). The two synthetic oligonucleotides (CCR5Se, 5ЈTGAGTGTTA CGCTGCAGCTCAGTGGGATTTCGGTAACACTATGTGTCAGCC-3Ј, and CCR5-As, 5ЈTCAGGCTGACACATAGTGTTACCGAAATCCCACTGAGCT GCAGCGTAACAC-3Ј) were obtained from PRIMM (Milan, Italy), denatured at 95°C, and reannealed by letting the temperature return to room temperature.…”

“…Both horizontal and vertical transmission of virus infection mainly occur by mucosal contacts (sexual intercourse and baby delivery) (29,33). Therefore, in the majority of new HIV infections, the genital mucosa is the environment where the first HIV-cell contacts take place and the region where immune protective mechanisms should be activated or promptly recruited (15).…”

A review and analysis of intensive care medicine in the least developed countries*

“…Although most LDCs show significantly higher tuberculosis and HIV prevalence than Western nations, the HIV pandemic has reached an unexpected magnitude in sub-Saharan Africa (92). In 2003, sub-Saharan Africa was home to two thirds of the world's people living with HIV/AIDS but only 11% of the world's total population (5).…”

“…Today, about one in 12 African adults lives with HIV/AIDS; among hospitalized patients, an estimated 20 -60% are infected with HIV (3). HIV carrier status substantially impairs survival chances of critically ill patients in LDCs (92). Overwhelming sepsis refractory to treatment often causes acute death even in asymptomatic HIV-infected patients.…”