HMOX1 Promotes Ferroptosis in Mammary Epithelial Cells via FTH1 and Is Involved in the Development of Clinical Mastitis in Dairy Cows

Abstract

Ferroptosis is associated with inflammatory diseases as a lethal iron-dependent lipid peroxidation; its role in the development of clinical mastitis (CM) in dairy cows is not well understood. The aim of this study was to identify differentially expressed proteins (DEPs) associated with iron homeostasis and apoptosis, and to investigate further their roles in dairy cows with CM. The results suggested that ferroptosis occurs in the mammary glands of Holstein cows with CM. Using data-independent acquisition proteomics, 302 DEPs included in 11 GO terms related to iron homeostasis and apoptosis were identified. In particular, heme oxygenase-1 (HMOX1) was identified and involved in nine pathways. In addition, ferritin heavy chain 1 (FTH1) was identified and involved in the ferroptosis pathway. HMOX1 and FTH1 were located primarily in mammary epithelial cells (MECs), and displayed significantly up-regulated expression patterns compared to the control group (healthy cows). The expression levels of HMOX1 and FTH1 were up-regulated in a dose-dependent manner in LPS induced MAC-T cells with increased iron accumulation. The expression levels of HMOX1 and FTH1 and iron accumulation levels in the MAC-T cells were significantly up-regulated by using LPS, but were lower than the levels seen with Erastin (ERA). Finally, we deduced the mechanism of ferroptosis in the MECs of Holstein cows with CM. These results provide new insights for the prevention and treatment of ferroptosis-mediated clinical mastitis in dairy animals.

SLC34A2 Targets in Calcium/Phosphorus Homeostasis of Mammary Gland and Involvement in Development of Clinical Mastitis in Dairy Cows

“…Lactating Holstein cows were diagnosed using veterinary udder examination, somatic cell count (SCC), and the Lanzhou Mastitis Test (LMT), as previously described [2,3,16]. Fresh mammary glands (MGs) from healthy Holstein cows (control group, CON/C, n = 3) or clinical mastitis cows (experiment group, CM, n = 3) were collected after slaughter at a commercial farm in Wuzhong City, Ningxia Province, China, as previously described [1,3,17]. The tissues were stored in liquid nitrogen or fixed with 4% paraformaldehyde immediately.…”

“…Co-localization analysis of SLC34A2 and cytokeratin18 (CK18, an epithelial cell marker) proteins in the MGs of the Con/C and CM groups was performed as previously described [3,16,17]. Briefly, the antigen-retrieved sections were incubated with primary antibodies (SLC34A2 and CK18 at a dilution ratio of 1:100) and then labeled with different colors of immunoglobulin G as described previously [1]. Nuclei were localized with 4,6diamidino-2-phenylindole (DAPI; Solarbio, Beijing, China).…”

“…The primer sequences were as follows: SLC34A2 (NM_174661.2) forward primer CAGTCTGCCAAGCCTGAGAA; and reverse primer, CTCTCTGACCACTTGAGCCC. PCR procedures, including RNA isolation, cDNA synthesis, primer design, and data calculation, were performed as previously described [1,3]. β-actin (NM_173979) forward primer and reverse primer CCAAGGC-CAACCGTGAGAA; R, CCAGAGGCATACAGGGACAG) were used as an endogenous control.…”

“…In the present study, significant differences in GO terms (p < 0.05, p.adjust < 0.05), including biological processes (BPs), molecular functions (MFs), and cellular components (CCs), were selected as candidate DEPs interacting with SLC34A2. Heat maps, enrichment circus graphs, volcano plots, and Venn diagrams were drawn using the OmicShare online platform (http://www.omicshare.com/tools, accessed on 20 December 2023) [1][2][3]. Protein-and-protein interaction (PPI), GO, and KEGG pathway networks of these DEPs were constructed using STRING 11.5 and Cytoscape 3.7.1 (IPA, Ingenuity Systems, www.ingenuity.com, accessed on 15 February 2024), including Clue Go and ingenuity pathway analysis [1,3,18].…”

“…Mastitis, an inflammatory condition of the mammary gland (MG), seriously affects milk production and quality, delays the postpartum estrus cycle and gestation, especially Animals 2024, 14, 1275 2 of 13 in cows with clinical mastitis (CM), and results in significant economic losses in the dairy industry. CM is induced by multiple factors, such as physicochemical stimuli, pathological infection, and immunological dissonance [1]. With these factors in mind, researchers have made substantial efforts to prevent and treat mastitis [2,3], achieving significant breakthroughs.…”