Homocysteine-Mediated Modulation of Mitochondrial Dynamics in Retinal Ganglion Cells

Abstract

This study provides the first evidence that homocysteine-induced ganglion cell loss involves the dysregulation of mitochondrial dynamics, both in vivo and in vitro. The present data suggest increased mitochondrial fission as a novel mechanism of homocysteine toxicity to neurons. Of particular relevance are glaucoma and Alzheimer's disease, neurodegenerative diseases that are associated with hyperhomocysteinemia and, more recently, have implicated increased mitochondrial fission in their pathogeneses.

Alterations of Retinal Vasculature in Cystathionine-Beta-Synthase Mutant Mice, a Model of Hyperhomocysteinemia

“…19 Quantitative real-time PCR was performed using Absolute QPCR SYBR Green Fluorescein Mix (Thermo Scientific, Surrey, UK) and the BioRad iCycler (BioRad, Hercules, CA). The primers used for qPCR were VEGF, upper ( C AT C T T C A AG C C G T C C T G T G T G C ) ; V E G F, 1 2 0 -l o w e r (CACCGCCTTGGCTTGTCACATT); and VEGF, 164-lower (GCGGAA CAAGGCTCACAGTGATT).…”

“…19 Briefly, protein samples were subjected to SDS-PAGE and transferred to nitrocellulose membranes, which were then incubated with mouse monoclonal anti-VEGF antibody (1:500) or a rabbit polyclonal anti-ZO-1 antibody (1:100) at 48C overnight, followed by a horseradish peroxidase (HRP)-conjugated goat antimouse IgG (1:5000) or goat antirabbit IgG antibody (1:3000). Proteins were visualized with the enhanced chemiluminescence (ECL) Western blot detection system.…”

“…18 Accompanying the retinal ganglion cell loss are altered mitochondria of the nerve fiber layer and increased expression of the mitochondrial proteins Opa1 and Fis1. 19 Functional studies revealed a gradual reduction of the light and dark amplitudes of the ERG, reduced direct current electroretinography (dc-ERG) light peak, and differences in visual transmission to the visual cortex when visual evoked potentials (VEPs) were recorded. 20 A much more severe retinal phenotype is observed in mice lacking the gene encoding CBS (cbs À/À mice).…”

“…18 Functional studies showed significantly reduced amplitudes of the dark-and light-adapted ERGs in the cbs À/À mice and a marked delay in the N1 implicit time determined by recording VEPs. 20 The data accumulated in hyperhomocysteinemic (cbs) mice show clear dysfunction of retinal neurons [18][19][20] ; however, there have been no investigations of the retinal vasculature in these mice. Given the clinical literature demonstrating a strong correlation between hyperhomocysteinemia and retinal occlusive disease, we investigated the vascular phenotype in cbs À/À mice as a model of profound hyperhomocysteinemia.…”

Homocysteine Facilitates Prominent Polygonal Angiogenetic Networks of a Choroidal Capillary Sprouting Model

“…Similar to neural degeneration, several retinal disorders have been associated with high levels of hcy. Elevated plasma hcy is a risk factor for retinal artery or vein occlusion, [11][12][13] and this condition is possibly improved by the intake of folate, vitamin B6, and vitamin B12 supplements, according to Martin et al 12 Hyperhomocysteinemia is also a main factor in the pathogenesis of retinal neuronal death, 14,15 diabetic retinopathy, 16 and even glaucoma. 17,18 However, the association between choroidal diseases and hcy levels has not yet been elucidated.…”