Homogenous overexpression of the extracellular matrix protein Netrin-1 in a hollow fiber bioreactor

Abstract

The production of recombinant proteins for functional and biophysical studies, especially in the field of structural determination, still represents a challenge as high quality and quantities are needed to adequately perform experiments. This is in part solved by optimizing protein constructs and expression conditions to maximize the yields in regular flask expression systems. Still, work flow and effort can be substantial with no guarantee to obtain improvements. This study presents a combination of workflows that can be used to dramatically increase protein production and improve processing results, specifically for the extracellular matrix protein Netrin-1. This proteoglycan is an axon guidance cue which interacts with various receptors to initiate downstream signaling cascades affecting cell differentiation, proliferation, metabolism, and survival. We were able to produce large glycoprotein quantities in mammalian cells, which were engineered for protein overexpression and secretion into the media using the controlled environment provided by a hollow fiber bioreactor. Close monitoring of the internal bioreactor conditions allowed for stable production over an extended period of time. In addition to this, Netrin-1 concentrations were monitored in expression media through biolayer interferometry which allowed us to increase Netrin-1 media concentrations tenfold over our current flask systems while preserving excellent protein quality and in solution behavior. Our particular combination of genetic engineering, cell culture system, protein purification, and biophysical characterization permitted us to establish an efficient and continuous production of high-quality protein suitable for structural biology studies that can be translated to various biological systems. Key points • Hollow fiber bioreactor produces substantial yields of homogenous Netrin-1 • Biolayer interferometry allows target protein quantitation in expression media • High production yields in the bioreactor do not impair Netrin-1 proteoglycan quality Graphical abstract

Lack of evidence for a role of anthrax toxin receptors as surface receptors for collagen VI and for its cleaved-off C5 domain/endotrophin

“…Antxr1: CAATGCTAGCGGGCCGCCGCGAGGATG (forward) and CAATGGATCCGACAGAAGGCCTTGGAGGAGG (reverse); Antxr2: CAATGCTAGCCCAGGAGCAGCCCTC (forward) and CAATCTCGAGTTGATGTGGAACCCGGGAG (reverse). Amplified PCR products were inserted into a modified sleeping beauty vector ( Moya-Torres et al., 2021 ). A construct coding for the full-length human NG2 cloned into the pEF6/MycHis-B vector was previously described ( Yuan et al., 2015 ).…”

Heparins mediate the multimer assembly of secreted Noggin

“…Human Noggin (Noggin, residues 28–232, Uniprot ID: Q13253) containing a C‐terminal double Strep II‐tag and a thrombin cleavage site were expressed using the inducible Sleeping Beauty transposon system in human embryonic kidney 293T cells as previously described 39,40 . The expression system design included a clonal selection step for improved homogeneous protein expression.…”

“…Human Noggin (Noggin, residues 28-232, Uniprot ID: Q13253) containing a C-terminal double Strep II-tag and a thrombin cleavage site were expressed using the inducible Sleeping Beauty transposon system in human embryonic kidney 293T cells as previously described. 39,40 The expression system design included a clonal selection step for improved homogeneous protein expression. The HEK 293T cells were grown to confluency in Dulbecco's modified eagle's medium supplemented with 5% fetal bovine serum before being transferred into a TripleFlask cell culture vessels (Nunclon; ThermoFisher Scientific Inc.) for expression.…”

LTBP1 promotes fibrillin incorporation into the extracellular matrix

“…cDNA encoding for full length human LTBP1L (NM_206,943; AA: 24À1721) and LTBP1S (BC144128; AA: 21À1395) were generated by gene synthesis (GeneArt Ò Strings, Thermofisher) and used for PCR amplification. PCR products were digested with the appropriate restriction enzymes and cloned into a modified Sleeping Beauty transposon expression vector containing a BM-40 signal peptide followed by a Twin-Strep-Tag [58,59].…”