Homozygous deletions localize novel tumor suppressor genes in B-cell lymphomas

Abstract

Integrative genomic and gene-expression analyses have identified amplified onco-genes in B-cell non-Hodgkin lymphoma (B-NHL), but the capability of such technologies to localize tumor suppressor genes within homozygous deletions remains unexplored. Array-based comparative genomic hybridization (CGH) and gene-expression microarray analysis of 48 cell lines derived from patients with different B-NHLs delineated 20 homozy-gous deletions at 7 chromosome areas, all of which contained tumor suppressor gene targets. Further investigation revealed that only a fraction of primary biopsies presented inactivation of these genes by point mutation or intragenic deletion, but instead some of them were frequently silenced by epigenetic mechanisms. Notably, the pattern of genetic and epigenetic inactivation differed among B-NHL subtypes. Thus, the P53-inducible PIG7/LITAF was silenced by homozygous deletion in primary mediastinal B-cell lym-phoma and by promoter hypermethyl-ation in germinal center lymphoma, the proapoptotic BIM gene presented ho-mozygous deletion in mantle cell lym-phoma and promoter hypermethylation in Burkitt lymphoma, the proapoptotic BH3-only NOXA was mutated and preferentially silenced in diffuse large B-cell lym-phoma, and INK4c/P18 was silenced by biallelic mutation in mantle-cell lym-phoma. Our microarray strategy has identified novel candidate tumor suppressor genes inactivated by genetic and epige-netic mechanisms that substantially vary among the B-NHL subtypes. (Blood. 2007; 109:271-280)

Primary mediastinal B‐cell lymphoma

“…18,38 The deletion site may however also include another potential tumour suppressor, PIG7/ LITAF, which has a role in the regulation of apoptosis. 39 In common with the idea that PMBL and HL share many common features (see below), SOCS-1 deletion mutations have also been detected in HL. 40 …”

Further delineation of chromosomal consensus regions in primary mediastinal B-cell lymphomas: an analysis of 37 tumor samples using high-resolution genomic profiling (array-CGH)

“…35 Additionally, homozygous deletions of approximately 0.7 Mb covering SOCS1 and PIG7/LITAF have been described in the Karpas1106P cell line using array-CGH. 36,37 In our array analysis, interstitial deletions on the chromosomal band 16q13.13 have not been identified; however, the critical region was not directly represented on the array (flanking DNA targets were localized approximately 1 Mb distance up-and 0.7 Mb downstream).…”

STAT6 activity is regulated by SOCS-1 and modulates BCL-XL expression in primary mediastinal B-Cell lymphoma

“…This phenoptype may be due to the deletion of p53-inducible genes previously reported in this cell line. 7 Letters to the Editor (GGAAGCAGGAAGAACTCAAGTT), led to a similar decrease in total STAT6 ( Figure 3D) and induced a 2.5 fold increased cell death as assessed by Nicoletti staining (subG1 cells ¼ 11 ± 1.2% in STAT6 shRNA versus 4.4±0.7% in control shRNA). As this effect could be due to the activation of an interferon response by siRNA, we tested whether transfection increased STAT1 levels or its phosphorylation.…”