Hop2 interacts with the transcription factor CEBPα and suppresses adipocyte differentiation

Lin, Tonghui; Zhang, Yang; Zhang, Tingting; Steckler, Rita A.; Yang, Xiangli

doi:10.1016/j.jbc.2021.101264

Cited by 7 publications

(11 citation statements)

References 54 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…Our result showed these morphological changes on the microscopy image as shown in Figure 3 A. During 3T3-L1 adipogenesis, C/EBP-α and PPAR-γ are activated by insulin with FBS [ 25 ]. We investigated the changes in the expression level of transcription factors such as PPAR-γ according to the application of MCS during adipogenesis.…”

Section: Resultsmentioning

confidence: 71%

See 1 more Smart Citation

Micro-Current Stimulation Can Modulate the Adipogenesis Process by Regulating the Insulin Signaling Pathway in 3T3-L1 Cells and ob/ob Mice

Lee

Kim

et al. 2023

Life

View full text Add to dashboard Cite

Obesity is a disease in which fat is abnormally or excessively accumulated in the body, and many studies have been conducted to overcome it with various techniques. In this study, we evaluated whether micro-current stimulation (MCS) can be applied to prevent obesity by regulating the adipogenesis through 3T3-L1 cells and ob/ob mice. To specify the intensity of MCS, Oil Red O staining was conducted with various intensities of MCS. Based on these, subsequent experiments used 200 and 400 μA for the intensity of MCS. The expressions of insulin signaling pathway-related proteins, including phosphorylation of IGF-1 and IR, were decreased in all MCS groups, and in turn, downstream signals such as Akt and ERK were decreased. In addition, MCS reduced the nucleus translocation of PPAR-γ and decreased the protein expression of C/EBP-α. In the ob/ob mouse model, MCS reduced body weight gain and abdominal adipose tissue volume. In particular, the concentration of triglycerides in serum was also decreased. Taken together, our findings showed that MCS inhibited lipid accumulation by regulating insulin signaling in 3T3-L1, and it was effective at reducing body weight and adipose tissue volume in ob/ob mice. These suggest that MCS may be a useful treatment approach for obesity.

show abstract

Section: Resultsmentioning

confidence: 71%

“…We also confirmed that MCS leads to a decrease in the expressions of C/EBP-α and PPAR-γ, which are known as transcription factors in the adipogenesis. In other studies, a reduction in transcription factors has been mentioned as an efficient strategy for inhibiting lipid accumulation [ 25 , 43 ]. It supported the results of our study.…”

Section: Discussionmentioning

confidence: 99%

Micro-Current Stimulation Can Modulate the Adipogenesis Process by Regulating the Insulin Signaling Pathway in 3T3-L1 Cells and ob/ob Mice

Lee

Kim

et al. 2023

Life

View full text Add to dashboard Cite

show abstract

“…The protein product consists of 217 amino acids in its monomer form, encoding a nuclear, tissue-specific protein with multiple functions, including a role in meiotic recombination and acting as a coactivator of ligand-dependent transcription mediated by nuclear hormone receptors, which is conserved in evolution (19,20). Previous studies demonstrated that, in PSMC3IP-knockout mice, the ovarian volume was reduced and germ cells were missing (21,22). PSMC3IP is a DNA-binding protein dimer, characterized by the presence of three domains including a leucine zipper domain, a DNA-binding domain and a RAD51/DMC1 interaction domain (13).…”

Section: Discussionmentioning

confidence: 99%

Two novel biallelic mutations in PSMC3IP in a patient affected by premature ovarian insufficiency

Mei

Huang

et al. 2021

Mol Med Rep

View full text Add to dashboard Cite

Premature ovarian insufficiency (POI) is a heterogeneous condition occurring when a woman experiences a loss of ovarian activity before the age of 40. POI is one of the most common reproductive endocrine diseases in women of childbearing age. The present study investigated the clinical manifestations and genetic features of a Chinese patient affected by POI. Next-generation whole-exome capture sequencing with Sanger direct sequencing were applied to the proband and her clinically unaffected family members. Two novel compound heterozygous mutations were identified in PSMC3IP. The first was a splicing mutation (c.597+1G>T) that was inherited from her father, whereas the second mutation (c.268G>C p.D90H) was discovered in both her mother and younger sister. The two mutations were co-segregated with the disease phenotype in the family. In conclusion, the findings of the present study further support the key role of PSMC3IP in the etiology of POI and provide a novel insight into elucidating the mechanisms of female infertility.

show abstract

“…A BeyoRT™ II cDNA kit (D7170M; Beyotime) was used to synthesize cDNA as indicated by the manufacturer. PCR was measured using QuantStudio™ 5 (Thermo Fisher Scientific) with TB Green® Premix Ex Taq™ II (Tli RNaseH Plus) (RR820Q; TaKaRa) under the condition of 95°C/30 s, 40 cycles of 95°C/5 s and 60°C/30 s. Primers for C4b (forward: 5′‐ACCCCCAGTACTTGCTGGAC‐3′; reverse: 5′‐ACCCTGTAGAGCAGAGCCTCTAA‐3′), 17 Cebpa (forward: 5′‐AGGTGCTGGAGTTGACCAGT‐3′; reverse: 5′‐CAGCCTAGAGATCCAGCGAC‐3′), 18 Lyz2 (forward: 5′‐TGCCAGAACTCTGAAAAGGAATGG‐3′; reverse: 5′‐CAGTGCTTTGGTCTCCACGGTT‐3′), 19 Spp1 (forward: 5′‐AGCAAGAAACTCTTCCAAGCAA‐3′; reverse: 5′‐GTGAGATTCGTCAGATTCATCCG‐3′) 20 and Gapdh (forward: 5′‐AGAACATCATCCCTGCATCCA‐3′; reverse: 5′‐CCGTTCAGCTCTGGGATGAC‐3′) 19 were obtained from references. PCR results were obtained with

{2}^{-\unicode{x02206}\unicode{x02206}{C}_{{\rm{t}}}}

with the internal reference of Gapdh .…”

Section: Methodsmentioning

confidence: 99%

In silico analysis and verification of critical genes related to vascular calcification in multiple diseases

Li,

Ruan,

Yang

et al. 2023

Cell Biochemistry & Function

View full text Add to dashboard Cite

Identifying a functional molecular therapeutic target of vascular calcification (VC) that will not affect normal osteogenic differentiation is a challenge. To address this aim, we screened the differentially expressed genes (DEGs) in different VC conditions, including endothelial‐osteogenic transition (EOT) (GSE167962), chronic kidney disease (CKD), and atherosclerosis (AS) (GSE159832). KEGG pathways, protein–protein interactions, and hub genes were also analyzed. The intersecting DEGs among the EOT, CKD, and AS groups were verified by quantitative reverse transcription polymerase chain reaction and immunohistochemistry in a DOCA‐salt hypertension mouse model. The phosphoinositide 3‐kinase–protein kinase B signaling pathway, ECM‐receptor interaction, chemokine signaling pathway, and focal adhesion were enriched in EOT and AS‐induced VC. ECM‐receptor interaction, PPAR signaling pathway, apelin signaling pathway, AMPK signaling pathway, adipocytokine signaling pathway, and cholesterol metabolism were enriched in CKD and AS‐induced VC. C4b, Cebpa, Lyz2, and Spp1 were also upregulated in EOT, CKD, AS, and hypertension. This study identified promising molecular targets for VC therapy.

show abstract

Hop2 interacts with the transcription factor CEBPα and suppresses adipocyte differentiation

Cited by 7 publications

References 54 publications

Micro-Current Stimulation Can Modulate the Adipogenesis Process by Regulating the Insulin Signaling Pathway in 3T3-L1 Cells and ob/ob Mice

Micro-Current Stimulation Can Modulate the Adipogenesis Process by Regulating the Insulin Signaling Pathway in 3T3-L1 Cells and ob/ob Mice

Two novel biallelic mutations in PSMC3IP in a patient affected by premature ovarian insufficiency

In silico analysis and verification of critical genes related to vascular calcification in multiple diseases

Contact Info

Product

Resources

About