Host-associated genetic differentiation in a seed parasitic weevil Rhinusa antirrhini (Coleptera: Curculionidae) revealed by mitochondrial and nuclear sequence data

Abstract

Plant feeding insects and the plants they feed upon represent an ecological association that is thought to be a key factor for the diversification of many plant feeding insects, through differential adaptation to different plant selective pressures. While a number of studies have investigated diversification of plant feeding insects above the species level, relatively less attention has been given to patterns of diversification within species, particularly those that also require plants for oviposition and subsequent larval development. In the case of plant feeding insects that also require plant tissues for the completion of their reproductive cycle through larval development, the divergent selective pressure not only acts on adults, but on the full life history of the insect. Here we focus attention on Rhinusa antirrhini (Curculionidae), a species of weevil broadly distributed across Europe that both feeds on, and oviposits and develops within, species of the plant genus Linaria (Plantaginaceae). Using a combination of mtDNA (COII) and nuclear DNA (EF1-alpha) sequencing and copulation experiments we assess evidence for host associated genetic differentiation within R. antirrhini. We find substantial genetic variation within this species that is best explained by ecological specialisation on different host plant taxa. This genetic differentiation is most pronounced in the mtDNA marker, with patterns of genetic variation at the nuclear marker suggesting incomplete lineage sorting and/or gene flow between different host plant forms of R. antirrhini, whose origin is estimated to date to the mid-Pliocene (3.77 Mya; 2.91-4.80 Mya).

Integrative analyses unveil speciation linked to host plant shift in Spialia butterflies

“…However, in sympatry this character can function in combination with others to test the existence of gene flow and speciation (Mallet ; Hernández‐Vera et al . ; Nosil ). We can assume that host plant choice and mitochondrial markers are a priori independent traits and their 100% match at individual level in sympatry strongly suggests the existence of two species based on the biological species concept (see a similar case in McBride et al .…”

Host plant preferences of Hyalesthes obsoletus, the vector of the grapevine yellows disease ‘bois noir’, in Switzerland

“…Hence, even though H. obsoletus is reported to be a polyphagous species, it appears that individuals are rather well adapted to a single host plant species. Such differences among individuals in plant species preference as well as in performance on potential host plants may indicate an ongoing host plant specialisation, which may lead in the medium term to a genetic diversification among populations and in the long term to speciation (Powell et al., 2006; Johannesen et al., 2008; Hendry, 2009; Hernandez‐Vera et al., 2010; Peccoud & Simon, 2010). Ongoing host plant specialisation in H. obsoletus is expected to affect the epidemiological cycles of the two stolbur strains, which in turn might influence the control of bois noir disease.…”

Morphological, molecular and biological evidence reveal two cryptic species inMecinus janthinusGermar (Coleoptera, Curculionidae), a successful biological control agent of Dalmatian toadflax,Linaria dalmatica(Lamiales, Plantaginaceae)

“…It has proven to be an appropriate marker in previous studies investigating differentiation within species and the determination of host‐plant affiliation within related species (e.g. Caldara et al , 2008; Hernández‐Vera et al , 2010). From newly collected material, the complete COII gene was amplified using the primers TL2‐J‐3038 (5′‐TAATATGGCAGATTAGTGCATTGGA‐3′) (Emerson et al , 2000) and TK‐N 3782 (5′‐GAGACCATTACTTGCTTTCAGT CATCT‐3′) (Harrison Laboratory, Cornell University, Ithaca, NY, U.S.A.).…”