How to Evolve a Complex Plastid? ‐ A Hypothesis

Abstract

The evolution of complex plastids in general and the phylogeny of the intermediate forms present in chlorarachniophytes and cryptophytes are considered. By comparing possible protein transport mechanisms in these algae, also taking into account problems in explaining horizontal gene transfer between eukaryotic nuclei, we arrive at the hypothesis that the initial step in the evolution of complex plastids was a primary endocytobiosis of the host (!) cell. Our hypothesis also explains why the nucleomorph (the reduced nucleus of a secondary endocytobiont) is not eliminated.

Topology of Euglena Chloroplast Protein Precursors within Endoplasmic Reticulum to Golgi to Chloroplast Transport Vesicles

“…Plasmid 1NLHCPglyc40, encoding a pLHCPII containing a glycosylation site at Asp 40 , was constructed using PCR to replace the sequence Asp 40 -Ile-Gln-Gln within the 1NLHCP presequence with the glycosylation sequence Asp 40 -Gly-Ser-Met. A PCR fragment was synthesized using Pfu polymerase (Stratagene) and 1 ng of 1NLHCP as template as described by the manufacturer using 20 pmol of the oligonucleotide CTTATGTTAACGGATCCATGGCTCCTGCAGTTA as the 5Ј-primer and 20 pmol of the oligonucleotide GACCATGATTACGCCAAGCG as the 3Ј-primer.…”

“…Plasmid 1NLHCP⌬138 -438 encoding a protein lacking a presequence glycosylation site and pLHCPII amino acids 46 -146 was constructed by using PCR to convert Asp 40 to Thr 40 . A PCR fragment was synthesized using Pfu polymerase (Stratagene) and 1 ng of 1NLHCPglyc40⌬138 -438 as template as described by the manufacturer using 20 pmol of the oligonucleotide CTCATAGTACTGGATC-CATGGCTCCTGCAGTTA as the 5Ј-primer and 20 pmol of the oligonucleotide GACCATGATTACGCCAAGCG as the 3Ј-primer.…”

“…Amplification conditions were 95°C for 5 min, 30 cycles of 55°C for 30 s, 75°C for 3 min, 95°C for 1 min, and a final cycle with the elongation time at 75°C extended to 5 min. The 5Ј-primer inserts a ScaI site into the PCR fragment and converts Asp 40 to Thr 40 . The PCR product was digested with ScaI-EcoRI and ligated into the HpaI-EcoRI-cut plasmid 1NLHCPglyc40⌬138 -438.…”

“…1) functions as a stop transfer membrane anchor sequence and to determine the orientation of pLHCPII within the membrane, glycosylation reporter and stromal targeting region deletion constructs were made, and their import into canine microsomes was studied. PCR was used to construct clone 1NLHCPglyc40 encoding a protein containing a glycosylation site at Asp 40 of pLHCPII in addition to the glycosylation site at Asp 148 (Fig. 3A).…”

Genomic Footprints of a Cryptic Plastid Endosymbiosis in Diatoms

“…Under this scenario, the chromalveolate ancestor contained a plastid of primary endosymbiotic origin [cyanobacterial (18)] that was shared with the green lineage and subsequently replaced by one of secondary (red algal) derivation. Although possible, this scenario is highly implausible because it not only argues against Plantae monophyly, which has been supported by recent phylogenomic studies (6,19), but more importantly, demands that the vast majority of chromalveolate nuclear genes with nonplastid functions It should be noted that these are provisional values and will be affected by the strength of the phylogenetic signal in any given protein or the absence of data from particular groups; that is, some apparently streptophyte-specific diatom green genes may simply be explained by the loss of the genes in other Viridiplantae (such as prasinophytes).…”