HPyV6 and HPyV7 in urine from immunocompromised patients

Abstract

Background Human polyomavirus 6 (HPyV6) and HPyV7 are two of the novel polyomaviruses that were originally detected in non-diseased skin. Serological studies have shown that these viruses are ubiquitous in the healthy adult population with seroprevalence up to 88% for HPyV6 and 72% for HPyV7. Both viruses are associated with pruritic skin eruption in immunocompromised patients, but a role with other diseases in immunoincompetent patients or malignancies has not been established. Methods PCR was used to determine the presence of HPyV6 and HPyV7 DNA in urine samples from systemic lupus erythematosus (n = 73), multiple sclerosis (n = 50), psoriasis vulgaris (n = 15), arthritic psoriasis (n = 15) and HIV-positive patients (n = 66). In addition, urine from pregnant women (n = 47) and healthy blood donors (n = 20) was investigated. Results HPyV6 DNA was detected in 21 (28.8%) of the urine specimens from SLE patients, in 6 (9.1%) of the urine samples from the HIV-positive cohort, and in 19 (40.4%) samples from pregnant women. HPyV7 DNA was only found in 6 (8.2%) of the urine specimens from SLE patients and in 4 (8.5%) samples from pregnant women. No HPyV6 and HPyV7 viruria was detected in the urine samples from the other patients. Conclusions HPyV6, and to a lesser extend HPyV7, viruria seems to be common in SLE and HIV-positive patients, and pregnant women. Whether these viruses are of clinical relevance in these patients is not known.

Detection of Quebec Polyomavirus DNA in Samples from Different Patient Groups

“…The consecutive urine samples from SLE patients, 47 urine samples from pregnant women and 30 of the 35 urine specimens from MS patients were previously tested for HPyV6 and HPyV7 [ 41 ]. HPyV6 DNA, but not HPyV7, was detected in the QPyV DNA-positive samples SLE5.9, PW10 and PW34, but not in the samples from MS patients.…”

“…This shows that simultaneous viruria of different HPyVs can occur. Co-detection of different HPyV has been previously reported, including BKPyV and JCPyV in urine from renal transplant recipients and hematological stem cell transplant patients [ 44 , 45 ], HPyV6 and HPyV7 in urine from pregnant women and SLE patients [ 41 ] and MCPyV and HPyV6 or MCPyV and LIPyV in the skin of liver transplant patients [ 46 ].…”

“…dev. : 40.5 years old; median: 39.9 years old), 22 were new diagnoses naive to treatment and 44 were experienced patients on treatment with a triple-based antiretroviral regimen including protease/reverse transcriptase/integrase inhibitors [ 41 ]. The study was approved by the local Ethic Committee of the University Hospital Tor Vergata (Rome, Italy) (protocol number 0027234/2018, 19 December 2018), and patients’ informed consent was ascertained.…”

Prevalence of MCPyV, HPyV6, HPyV7 and TSPyV in Actinic Keratosis Biopsy Specimens

“…For HPyV6, the following primers were used to amplify a 299 bp fragment of LT: HPyV6 F: CAATGCATCACTACCTGGAC (nucleotides 4316-4335 in isolate 601a; HM011558) and HPyV6 R: GTTTGGGATTTCCGTTTGTG (nucleotides 4595-4614 in isolate 601a; HM011558). For HPyV7, a 344 bp fragment of LT was amplified using the primers HPyV7, F: CACGCAGGGCTTCCATATGG (nucleotides 4267-4282 in isolate 713a; HM011586) and HPyV7 R: GGTTTAAGAGCCTGCTGTTG-3 (nucleotides 4591-4610 in isolate 713a; HM011586) [25]. The PCR conditions were 40 cycles of 30 s at 90 • C, 30 s at 55 • C, and 1 min at 72 • C. PCR was performed with Accustart II PCR SuperMix (Quantabio, Beverly, MA, USA).…”

BK Polyomavirus—Biology, Genomic Variation and Diagnosis

“…The other virus, later named JC virus, was isolated post mortem from the brain tissue of a patient with progressive multifocal leukoencephalopathy [ 8 , 9 ]. There have now been 15 polyomaviruses identified in humans, most of them in the last ten years [ 10 ]. In 2007 two new polyomaviruses were identified, KI (KIPyV) and WU (WUPyV), named after the universities where they were discovered (Karolinska Institutet and Washington University).…”